Abstract
Background/Aim: Chronic inflammation is believed to play a critical role in the pathogenesis of lung cancer. Interleukin-8 (IL-8) is an inflammatory cytokine and plays an important role in cancer development. Few studies have investigated the association between interleukin-8 - 251T/A (rs4073) genotype and lung cancer risk in various populations. Materials and Methods: In the current study, genotypes of interleukin-8 rs4073 were analyzed in 358 lung cancer patients and 716 healthy controls in Taiwan, by the PCR-RFLP methodology. Results: The distribution frequencies of interleukin-8 rs4073 genotypes between control and case groups were compared, and the homozygous variant AA genotypes showed a lower percentage in the case group compared to the control group (OR=0.57, 95%CI=0.39-0.85, p=0.0059). The distributions of alleles frequencies also exhibited statistical difference (p=0.0066). There was an interaction between interleukin-8 rs4073 and smoking habits (p=0.0051). Conclusion: Interleukin-8 rs4073 genotypes were associated with lung cancer susceptibility, especially for smokers.
Lung cancer remains the deadliest cancer globally for both males and females (1). Worldwide, new diagnosed lung cancer cases are about 2.1 million, and annual deaths are about 1.8 million annually (2). Among the various types, non-small cell lung cancer (NSCLC) is the most prevalent. Despite serious improvements in diagnostic and therapeutic technologies, NSCLC cases currently remain of relatively poor prognosis, and the 5-year survival rates remain as low as 20% (3). It is important to discover reliable biomarkers for effective early diagnosis of lung cancer, that can help decrease its prevalence and increase 5-year survival rates.
It has been proposed that there is certain heritability in lung cancer (4), and familial studies speculated that heritability may contribute approximately 8% to lung cancer risk (5). As for environmental factors, cigarette smoking behaviors may contribute to mutation prevalence for lung cancer initiation (6-8). Tobacco smoking has been reported to induce pulmonary inflammation (9) and cause obstructive pulmonary disease (COPD) (10), which is a potential factor for lung cancer (11). According to the information mentioned above, since smoking behavior in addition to those newly revealed genetic markers can both contribute to lung cancer risk, they should be taken into consideration together.
Chronic inflammation is believed to play a critical role in tumor initiation (12). Mounting evidence has been provided for chemokines and the role of the interaction between them and their receptors in cancer progression (13, 14). Interleukin-8 (IL-8, CXCL8), is a cytokine member, and also a chemo-attractant of neutrophils and lymphocytes (15). Interleukin-8 is produced by various normal cells such as monocytes, neutrophils, fibroblasts and endothelial cells (16), and plays a role in initiation of acute inflammatory responses (17). Under some abnormal conditions, interleukin-8 is also produced by tumor cells (18) and has been shown to be involved in angiogenesis and tumor growth (19, 20). Interleukin-8 is also overexpressed in a panel of tumors, such as gastric cancer and breast cancer, and is involved in tumor behaviors including invasive and metastatic capacity (21-23). Most important, the level of mRNA expression for interleukin-8 was found overexpressed in NSCLC patients compared to healthy controls (24).
Several polymorphisms T–251A, C+781T, C+1633T, and A+2767T have been investigated in the interleukin-8 gene (25), and the production of interleukin-8 has been reported to be closely regulated by the T-251A (rs4073), which is located at its promoter region (26). In addition to the elevated level of mRNA in lung cancer tissues (24), A allele of interleukin-8 rs4073 has been reported to associate with overexpression of interleukin-8 protein (27). The elevated interleukin-8 level has been further reported to associate with disease recurrence in a panel of human cancers, such as colorectal, breast, gastric cancer, and most of all lung cancer (28-31). Following this rationale, scientists have provided evidence on the association of interleukin-8 genotypes with the susceptibility to several kinds of cancers, such as gastric (32, 33), liver (34), nasopharyngeal (25), and oral cancer (35). Thus, we aimed to investigate the contribution of interleukin-8 genotypes to lung cancer risk. Furthermore, we summarized previously published papers on interleukin-8 genotype contribution to lung cancer risk.
Materials and Methods
Patient population. This study has been approved by the ethics committee of China Medical University Hospital (DMR100-IRB-284) and sheets of informed consent has been obtained from all the attendants. Including criteria for the cases are that they were newly diagnosed by expert pathology diagnosis. Excluding criteria for the cases with any other types of cancer, possible tumors, infectious and immune diseases. The attendants are all Taiwanese.
Genotyping of interleukin-8 rs4073. Peripheral blood was collected from lung cancer cases and controls and the genomic DNA was extracted (36-38). The genotypes at interleukin-8 rs4073 were determined by polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) methodology (25, 39, 40). Briefly, the primer sequences of interleukin-8 rs4073 were designed by Terry Fox Cancer Research Lab with forward and reverse primer pairs (TCATCCATGATCTTGTTCTA and GGAAAACGCTGTAGG TCAGA). The PCR conditions was set at a total volume of 25 μl, starting with pre-denaturation at 94°C for 2 min; followed by 35 cycles of 94°C degeneration for 20 s, 57°C annealing for 20 s, 72°C extension for 20 s; and finally, 72°C extension for 20 min. The PCR products of interleukin-8 rs4073 were digested by Mfe I, with digestible A allele cut into 449 + 75 bps, while undigested T allele were intact 524 bp. All the PCR adducts were checked by 3% agarose gel electrophoresis by two double-blinded researchers. Samples of the 3% PCR adducts were randomly selected for direct sequencing to verify the accuracy and reliability.
Statistical analysis. The Student’s t-test was adopted to check the distributions of ages. The Pearson’s Chi-square methodology was used in checking the distribution pattern of interleukin-8 rs4073 genotypes and the interaction between interleukin-8 rs4073 genotypes and smoking status. The contribution of interleukin-8 rs4073 genotypes to lung cancer risk are also verified by the odds ratios (ORs) and the 95% confidence intervals (CIs). p-Value less than 0.05 is considered to be significant.
Results
The distribution of age, gender and smoking behaviors of lung cancer cases and healthy controls are shown in Table I. Also, the histological classifications of lung cancer cases are also shown. There was no difference in distribution of age, gender and smoking behavior between cases and controls (p-values all >0.05) since we matched the two groups with these indexes (Table I). As for the histopathological subtypes, 60.9% (218 in number) were adenocarcinomas, 29.6% (106 in number) were squamous cell carcinomas, and 9.5% (34 in number) were other types.
The genotypic distributions of interleukin-8 rs4073 among the controls and lung cancer patients are presented and analyzed in Table II. First, the genotype frequencies of interleukin-8 rs4073 among the control individuals were in Hardy-Weinberg equilibrium (p=0.3256). Second, the genotypes of interleukin-8 rs4073 were differently distributed between lung cancer and healthy control groups (p for trend=0.0222) (Table II). In detail, the interleukin-8 rs4073 homozygous variant AA genotype was associated with a lower lung cancer risk, compared with wild-type homozygous TT genotype (OR=0.57, 95%CI=0.39-0.85, p=0.0059), while the heterozygous AT was not (OR=0.84, 95%CI=0.64-1.11, p=0.2157). Third, in the recessive model, there seemed to be a significant 0.63-fold decreased lung cancer risk for those homozygous variant AA genotype carriers at interleukin-8 rs4073, compared to those carrying TT+AT genotypes (OR=0.63, 95%CI=0.44-0.91, p=0.0139). Fourth, in the dominant model, there was a similar trend of decreased lung cancer risk for carriers of the AT+AA genotype at interleukin-8 rs4073, compared to TT carriers (OR=0.77, 95%CI=0.59-0.99, p=0.0445). We have a temporary summary that homozygous variant AA genotype carriers at interleukin-8 rs4073 had a significant lower risk of lung cancer.
To validate the results in Table II, the allelic frequency distribution analysis for the interleukin-8 rs4073 was conducted, and the results are shown in Table III. The variant A allele was 35.5% in the lung cancer group and 41.6% in the control group (OR=0.77, 95%CI=0.64-0.93, p=0.0066, Table III). It supported the finding that A allele was associated with lower risk of lung cancer in Taiwan.
As we mentioned above, personal smoking behavior is a behavioral risk factor for lung cancer, and we were interested in examining the interactions between interleukin-8 rs4073 genotype and personal smoking habit. Among the non-smokers, those with interleukin-8 rs4073 AT and AA variant genotypes were at 0.84- and 0.81-fold odds of having lung cancer (95%CI=0.46-1.66 and 0.35-1.88, p=0.6805 and 0.6174, respectively). Even after the adjustments of age, gender and alcohol drinking status, the level is much similar and did not reach a significant level (adjusted OR=0.77 and 0.69, 95%CI=0.42-1.48 and 0.34-1.67, respectively). Among smokers, those with interleukin-8 rs4073 AT and AA genotypes were at 0.84- and 0.53-fold odds of having lung cancer (95%CI=0.62-1.14 and 0.41-0.83, p=0.2536 and 0.0051). The difference was even more significant after adjusting for age, gender and alcohol drinking status for AA genotype (adjusted OR=0.41, 95%CI=0.25-0.71, Table IV).
Discussion
During the evolutionary history of tumors, a complicated and dynamic communication between tumor cells and cells of the tumor microenvironment has been identified. There is a myriad of cytokines involved. Among them, interleukin-8 is a major mediator of inflammation, acting as a chemoattractant for neutrophils, basophils, and T cells (41). Elevated levels of interleukin-8 has been reported to correspond to an increased disease severity such as the metastatic potential of melanoma (42), breast (43), ovarian (44), renal (45), prostate (46), pancreatic (47), gastric (48, 49) and colorectal cancer (50, 51). However, the contribution of interleukin-8 genotypes has not been well established. In the current study, we revealed that the genotype profile of Taiwanese for TT, AT, and AA at interleukin-8 rs4073 are 35.0%, 46.8%, and 18.2% in the Taiwan healthy control population, respectively (Table II). Among lung cancer cases, the interleukin-8 rs4073 AA genotype was statistically significantly lower (12.3%) than the controls (Table II). We validated the data via carrier comparisons and allelic frequency analysis, finding that variant AA genotype and A allele contribute to decreased lung cancer risk (Table II and Table III). Cigarette smoking is one of the environmental contributors for lung cancer risk (52, 53), however, its interactions with interleukin-8 rs4073 genotypes have not been examined. This study is the first to reveal that there is a significant interaction between AA interleukin-8 rs4073 genotypes with personal smoking habits for lung cancer risk (Table IV). Studies have shown that protein levels of interleukin-8 were significantly higher in small-airway epithelial cells under smoking extract treatments (54, 55). However, the detailed mechanisms of how interleukin-8 genotype contributes to lung cancer etiology require further investigation.
To our surprise, in literature, there are limited studies mentioning interleukin-8 rs4073 genotypes with lung cancer risk, and we aimed to summarize the contribution of interleukin-8 rs4073 genotypes to lung cancer risk. In 2005, Campa and his colleagues have investigated the contribution of interleukin-8 rs4073 genotypes to lung cancer risk and did not find a critical role of interleukin-8 rs4073 in lung carcinogenesis within a mixed population containing 2,116 controls and 2,144 cases (56). In 2007, Lee and colleagues have investigated the role of interleukin-8 rs4073 genotypes in lung cancer risk determination in a relatively small China population containing 112 controls and 119 cases. Again, no significant association was found (57). In 2008, Vogel and colleagues examined the association of interleukin-8 rs4073 polymorphisms with lung cancer susceptibility in a Danish population containing 744 controls and 403 cases. Consistent with the previous literatures, there is neither an association between interleukin-8 rs4073 and lung cancer risk, nor interaction between interleukin-8 rs4073 genotypes and smoking status (58). In 2013, Rafrafi and colleagues tested the contribution of interleukin-8 rs4073 genotypes to lung cancer risk in an African population containing 225 controls and 175 cases, finding that TT genotypes at interleukin-8 rs4073 was significantly associated with an increased lung cancer risk. Clinical analysis indicated a positive association of interleukin-8 rs4073 T allele among adenocarcinoma patients and large tumor size and high-grade stage (24). Most interesting, a higher level was even found in NSCLC patients, especially those carrying interleukin-8 rs4073 T/T genotype (24). In the same year, Bhat and colleagues examined an Indian population containing 200 controls and 190 cases, finding that there is no positive association (59). There is a great difference among different ethics, and the various types of lung cancer patients collected may also contribute to different findings. We have summarized all the updated interleukin-8 rs4073 genotyping studies according to the various types of lung cancer mentioned above in Table V. The positive findings by Rafrafi in India and Li in Taiwan need to be validated in larger sample size and various populations.
There are still some other SNPs at interleukin-8 worth of further investigations, such as C+781T, C+1633T, and A+2767T. The interleukin-8 rs4073 located in the promoter region of interleukin-8, and other polymorphic sites may also alter the functions of its coded protein. For instance, C+781T (rs2227306), an intronic polymorphic site, have been reported to determine the levels of interleukin-8 expression (60). We cannot exclude the possibility that other SNP(s) other than rs4073, can serve as predictive marker(s) for lung cancer. Second, the mRNA level of intereleukin-8 was reported to be higher in NSCLC patients than healthy controls, and those who carry interleukin-8 rs4073 TT genotype may have higher levels among the various genotypes (24). This should be validated in larger and different populations. Third, the role of interleukin-8 rs4073 genotypes in cancer risk determination is inconclusive and requires more evidence for validation. For instance, in nasopharyngeal cancer (25), similar to the current study in lung cancer, A allele in interleukin-8 rs4073 genotypes is associated with decreased cancer risk, while in oral cancer, A allele is associated with increased cancer risk (61). Last, the detail mechanisms of how interleukin-8 interacts with other cytokines in lung cancer etiology needs further investigation.
Conclusion
In conclusion, this study provides evidence that the A allele at interleukin-8 rs4073 may serve as a predictor for lung cancer risk. Furthermore, an obvious interaction of smoking status with interleukin-8 rs4073 genotype on personal susceptibility to lung cancer is herein presented.
Acknowledgements
We appreciate the team of Hsia in collection of all the participants. The perfect PCR-RFLP technology and efforts from Yu-Chen Hsiau are appreciated. This study is supported by the grant from China Medical University Hospital and Asia University (ASIA-110-CMUH-04) and China Medical University Hospital (DMR-110-029).
Footnotes
↵* These Authors contributed equally to this study.
Authors’ Contributions
Research Design: Li CH, Yang YC and Hsia TC; Patient and Questionnaire Summarize: Li CH, Shen TC and Shen YC; Experiment Data Clearing and Checking: Chang WS and Wang YC; Statistical Analysis: Yang YC and Tsai CW; Manuscript Writing: Tsai CW and Bau DT; Reviewing and Revising: Bau DT.
Conflicts of Interest
The Authors declare no conflicts of interest with regard to the study.
- Received October 25, 2021.
- Revision received November 17, 2021.
- Accepted January 13, 2022.
- Copyright © 2022 International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.