Research ArticleExperimental Studies
Open Access

Gossypol Inhibits GLI3-dependent SHH Signaling to Selectively Target SPOP-deficient Breast Cancer Cells

PATRICIA AUGUSTINE, JAZMIN CHAVARRIA and MARIEKE BURLESON
Anticancer Research May 2026, 46 (5) 2317-2327; DOI: https://doi.org/10.21873/anticanres.18119

Abstract

Background/Aim: Breast cancer remains one of the leading causes of cancer-related mortality among women. The molecular heterogeneity of breast cancer, reflected in its numerous subtypes with variable responses to conventional and targeted therapies, necessitates the development of novel therapeutic strategies. Speckle-type POZ protein (SPOP), a substrate adaptor for Cul3-dependent ubiquitin ligase complexes, is frequently downregulated in breast cancer, yet the mechanisms linking SPOP loss to breast oncogenesis are poorly understood. This study aimed to elucidate the role of SPOP deficiency in breast cancer progression and identify potential therapeutic vulnerabilities associated with this molecular context.

Materials and Methods: MCF-7 breast cancer cells were subjected to SPOP knockdown to assess effects on cell proliferation and Sonic Hedgehog (SHH) signaling activity. A natural compound library was screened to identify agents selectively targeting SPOP-deficient cells. Candidate compounds were evaluated for effects on cell viability, GLI3 target gene expression, and clonogenic growth.

Results: SPOP knockdown in MCF-7 cells increased proliferation and led to hyperactivation of GLI3-dependent SHH signaling. Screening of the natural compound library identified gossypol as a selective inhibitor of SPOP-deficient cells. Gossypol treatment significantly reduced cell viability, suppressed GLI3 target gene expression and impaired clonogenic growth in SPOP-deficient cells, while exerting minimal effects on control cells.

Conclusion: These findings identify a novel oncogenic role for SPOP loss in promoting breast cancer progression via GLI3-dependent SHH signaling. Furthermore, gossypol is highlighted as a potential targeted therapeutic agent for breast cancers characterized by SPOP deficiency.

Keywords:

Introduction

Breast cancer remains the second leading cause of cancer-related deaths among women, highlighting the urgent need for improved therapeutic strategies (1). Although chemotherapy and radiation remain standard frontline treatments, both approaches present major challenges. They are frequently associated with severe side effects including fatigue, nausea and heightened risk of infection, and their effectiveness varies widely across different molecular subtypes of breast cancer (2-4). This variability highlights the importance of developing personalized treatment approaches that not only enhance therapeutic response but also minimize toxicity.

Breast cancer initiation and progression are primarily driven by genetic alterations, including mutations and changes in gene expression. Well-characterized examples include overexpression of the estrogen receptor (ER) and progesterone receptor (PR) and amplification or overexpression of HER2 (5, 6). A lesser-known subtype involves downregulation of the speckle-type POZ protein (SPOP). A study showed that SPOP copy number loss occurs in 60-70% of breast cancer cell lines and loss of heterozygosity at the SPOP locus was detected in 57.8% of 45 primary breast cancer samples (7). Furthermore, one study revealed that 45% of invasive ductal carcinoma specimens displayed reduced SPOP expression and that low expression of SPOP is correlated with poor overall survival (8). While the prevalence of SPOP downregulation in breast cancer strongly suggests a role for SPOP in breast cancer oncogenesis, the mechanisms underlying its contribution remain poorly understood.

SPOP is a MATH domain-containing protein, thus establishing its role in protein degradation through substrate recognition as part of a Cul3-dependent ubiquitin ligase complex (9, 10). Given that SPOP has a broad range of target proteins, it has attracted particular interest in cancer biology. Across numerous tumor types, SPOP functions predominantly as a tumor suppressor and its loss, through mutation or reduced expression, promotes tumorigenesis (11). Accordingly, the mutational and expression landscapes of SPOP have been extensively catalogued, revealing alterations across a wide spectrum of human cancers (11). Functional loss of SPOP promotes hyperactivated GLI3-dependent Sonic Hedgehog (SHH) signaling in prostate cancer through a mechanism that involves stabilization of GLI3 (12). The importance of SPOP loss and subsequent activation of SHH signaling have also been demonstrated in developmental settings (13-15). SHH signaling has been linked to breast development and homeostasis, with dysregulation of this pathway being a key player in breast cancer tumorigenesis (16-19). Thus, it was hypothesized that loss of SPOP in breast cancer promotes GLI3-dependent SHH hyperactivation to drive tumorigenesis. Furthermore, this would indicate that targeted compounds against GLI3 can provide a superior treatment regimen for patients with SPOP-downregulated breast cancer.

Drug discovery efforts suggest that ~60% of future anticancer agents will be derived from natural sources (20). A number of such compounds have already demonstrated potent anticancer activity, either as stand-alone therapies or in combination with conventional chemotherapeutics (20-22). A key advantage of natural products is their ability to reduce the adverse side effects typically associated with chemotherapy (20, 21). Despite this advantage, no studies to date have specifically explored natural compounds in the context of SPOP-altered breast cancer. To address this gap, the DiscoveryProbe natural compound library was screened for agents capable of suppressing the proliferation of breast cancer cells with reduced SPOP expression, and the ability of these compounds to reverse tumorigenesis by targeting the GLI3-dependent SHH signaling pathway was investigated.

Materials and Methods

Cell culture. MCF-7 control and SPOP knockdown cells were maintained at 37°C in a humidified atmosphere containing 5% CO2. Cells were grown in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific, Inc., Waltham, MA, USA) and a penicillin-streptomycin-L-glutamine mixture (Invitrogen; Thermo Fisher Scientific, Inc.).

Generation of knockdown cell lines. HEK293T cells were co-transfected with plasmids containing either a non-targeting control shRNA (sc-108060 Control shRNA plasmid from Santa Cruz Biotechnology, Dallas, TX, USA) or SPOP-specific shRNA (sc-63057-SH SPOP shRNA plasmid from Santa Cruz) or GLI3-specific shRNA (sc-35483-PR GLI3 shRNA plasmid from Santa Cruz) along with the packaging plasmids psPAX2 and pMD2.G (Invitrogen; Thermo Fisher Scientific, Inc.). The resulting viral supernatants were collected and used to infect MCF-7 cells, which were subsequently selected in a medium containing 1 μg/ml puromycin.

Treatment of cells with gossypol, cyasterone, or spiramycin I. The DiscoveryProbe natural compound library was originally purchased from APExBIO (https://www.apexbt.com/discoveryprobetm-natural-product-library.html). Gossypol, cyasterone and spiramycin I was purchased in larger quantities from MedChemExpress in powder form, reconstituted as a 10 mM stock in DMSO and stored in aliquots at −80°C. For the drug exposure experiments, drugs were freshly thawed and cells were plated at optimized densities in 96-, 24-, or 6-well plates in 60- or 100-mm dishes. After 24 h, the culture medium was replaced with fresh medium containing the indicated drug concentration or an equivalent volume of DMSO as a vehicle control.

Reverse transcription-quantitative PCR (RT-qPCR). A total of 5×105 cells were plated in a 60-mm dish, and total RNA was isolated 2 days later using TRIzol. For the drug treatment experiments, a total of at 4×105 cells/60-mm dish were seeded on day 1, treated with the indicated compound on day 2 and collected for RNA isolation on day 4. cDNA was synthesized using total RNA, oligo(dT) primers and SuperScript III Reverse Transcriptase (Invitrogen; Thermo Fisher Scientific, Inc.), following the manufacturer’s instructions. Briefly, 1 μg of total RNA was combined with 1 μl of oligo(dT) primer and nuclease-free water to a total volume of 13 μl, heated at 65°C for 5 min, and immediately chilled on ice. An RT master mix containing 4 lL 5X First-Strand Buffer, 1 μl 0.1 M DTT, 1 μl 10 mM dNTP mix and 1 μl SuperScript III Reverse Transcriptase was then added to each reaction to a total volume of 20 μl. The reactions were incubated at 50°C for 50 min, followed by enzyme inactivation at 70°C for 15 min. Quantitative PCR (qPCR) was performed using SYBR Green PCR Master Mix (ThermoFisher Scientific, Inc.) on a StepOnePlus Real-Time PCR System. Each 20-μl reaction contained 10 μl of SYBR Green Master Mix, 0.5 μM of each forward and reverse primer and 2 μl diluted cDNA template. The thermocycling conditions were: An initial denaturation step at 95°C for 10 min, followed by 40 cycles at 95°C for 15 s and at 60°C for 1 min. Melting curve analysis was performed to confirm reaction specificity. Relative gene expression levels were calculated using the comparative threshold cycle (2−ΔΔCq) method, with expression normalized to the designated housekeeping gene and presented as fold change relative to control samples. The following primer sequences were used for qPCR are as follows: GLI1 (forward: primer, TTTGGACCCAACTTGCCCAA; reverse primer, GCCCTATGTGAAGCCCTATT), ASCLI (forward primer, AAGAGCAACTGGGACCTGAGTCAA; reverse primer, AGCAAGAACTTTCAGCTGTGCGTG), CREB5 (forward primer, CGTGCCTCCTTGAAACAAGCCATT; reverse primer, ATGAAACACCAGCACCTGCCTAGA) and NGN2 (forward primer, AGGGCAGGTGTAGCCTTTCTGATT; reverse primer, CGCCACCCTTGGCTTTGACAATAA).

Western blot and co-immunoprecipitation. For western blotting, whole-cell lysates were collected, and 100 μg of total protein was separated on a 10% SDS-PAGE gel. Proteins were detected using the following primary antibodies at the indicated dilutions: anti-SPOP (1:500; cat. no. MA5-50809; Invitrogen; Thermo Fisher Scientific, Inc.), anti-GLI3 (1:1,000; cat. no. PA5-28029; Invritrogen; Thermo Fisher Scientific, Inc.) and anti-TFIIEβ (1:3,000; Cat. no. 11596-1-AP; Invitrogen; Thermo Fisher Scientific, Inc.). For co-immunoprecipitation assays, whole-cell lysates were prepared with Invitrogen Whole Cell Extraction Buffer supplemented with protease and phosphatase inhibitors. Cells were lysed on ice for 30 min, cleared at 14,000×g for 10 min at 4°C, and equal protein amounts were incubated overnight at 4°C with anti-GLI3 antibody. Normal IgG served as a negative control. The following day, protein A/G agarose beads were added for 2 h at 4°C and washed thoroughly in lysis buffer. Bound proteins were eluted by boiling in Laemmli sample buffer and analyzed by SDS-PAGE and immunoblotting to assess SPOP co-precipitation.

Proliferation assay. A total of 1×104 cells/well were plated in 24-well plates, with three technical replicates, in 2 ml DMEM. At the indicated time points, cells were collected using standard trypsinization procedures and counted with a hemocytometer. For the drug treatment experiments, the medium was replaced 24 h after seeding with DMEM containing either DMSO or the desired amount of the indicated drug.

Correlation and survival analysis. Kaplan-Meier plotter was used to generate the overall survival (OS) curve (https://kmplot.com/analysis/index.php?p=service&cancer=breast). The analysis was conducted for ER positive, PR positive and HER2 negative status to recapitulate MCF-7 breast cancer cells. Patients were categorized into low and high SPOP expression groups and split by auto select best cutoff. p-Value of survival analysis was computed using long-rank test.

MTT assay. A total of 1×104 cells/well were plated in 96-well plates, with three technical replicates, in 100 μl DMEM. After 24 h, the medium was replaced with DMEM containing either DMSO or 1 μM of the indicated drug. After 2 days, cell viability was assessed using the CyQUANT MTT Viability Assay (Thermo Fisher Scientific, Inc.) according to the manufacturer’s instructions. Relative cell density was calculated by normalizing absorbance values to the DMSO control.

Sulforhodamine B (SRB) assay. A total of 1×104 cells/well were seeded in 96-well plates, plated in triplicate, in 100 μl DMEM. After 24 h, the medium was replaced with DMEM containing either DMSO or 1 μM of the indicated drug. After 72 h of treatment, cells were fixed by adding cold 10% trichloroacetic acid (TCA) directly to the culture medium and incubated at 4°C for 1 h. Plates were washed with distilled water, air-dried and stained with 0.4% (w/v) sulforhodamine B (SRB) in 1% acetic acid for 30 min at room temperature. Excess dye was removed with multiple washes using 1% acetic acid, and plates were air-dried. Bound dye was solubilized in 10 mM Tris base (pH 10.5), and absorbance was measured at 510 nm using a microplate reader. Relative cell density was calculated by normalizing absorbance values to the DMSO control.

Colony formation assay. For the standard colony formation assay, a total of 4,000 cells/well were plated in 6-well plates containing 2 ml DMEM. After 24 h, the medium was replaced with DMEM supplemented with either DMSO or the desired amount of the indicated drug. The medium was refreshed every 3 days. On day 21, cells were washed with PBS, fixed in 10% paraformaldehyde and stained with 0.1% crystal violet. For the reverse colony formation assay, cells were seeded as described for the standard colony formation assay and the medium was replaced every 3 days. On day 21, the medium was removed and replaced with DMEM supplemented with either DMSO or the desired amount of the indicated drug. After 2 days of drug treatment, cells were washed with PBS, fixed in 10% paraformaldehyde and stained with 0.1% crystal violet.

Statistical analysis. All statistical analyses were conducted using a two-tailed unpaired, type 2 Student’s t-test. p<0.05 was considered statistically significant difference. For Figure 1 and Figure 2, results from shSPOP and/or shSPOP+shGLI3 samples were compared to shCT controls. No statistical analysis was performed in Figure 3 and Figure 4. In Figure 5, Figure 6, and Figure 7, drug-treated samples were compared with DMSO-treated controls.

Figure 1.
Figure 1.

Verification of SPOP knockdown in MCF-7 breast cancer cells. (A) Quantitative RT-PCR analysis confirming reduced SPOP expression in MCF-7 cells infected with shSPOP compared to cells infected with the control pLKO.1 vector (shCT). SPOP mRNA levels were normalized to GAPDH and are shown relative to control (shCT). Data represent mean±SEM from four independent experiments. Statistical significance was determined using an unpaired two-tailed Student’s t-test (*p<0.001). (B) Western blot analysis further confirming decreased SPOP protein expression following shSPOP infection. SPOP: Speckle-type POZ protein; SEM: standard error of the mean.

Figure 2.
Figure 2.

SPOP knockdown enhances cell proliferation and activates GLI3-dependent SHH signaling. (A) Cell proliferation analysis comparing MCF-7 control cells (shCT) with SPOP single knockdown (shSPOP) or SPOP and GLI3 double knockdown (shSPOP+shGLI3). Data represent mean±SEM from three independent experiments. (B) Quantitative RT-PCR assessment of GLI3 target gene expression (GLI1 and CREB5) and GLI3 in shCT, shSPOP, and shPOP+shGLI3 cells. Transcript levels were normalized to GAPDH and expressed relative to shCT. Data represent mean±SEM from three independent assays. (C) Western blot with single SPOP knockdown and double SPOP and GLI3 knockdown. (D) MCF-7 whole-cell lysates were subjected to immunoprecipitation (IP) with antibodies specific for GLI3 or isotype matched IgG. IPs were processed by Western blot analysis using GLI3- and SPOP-specific antibodies as indicated. INPUT, 10% of lysate used in IP. (E) Low SPOP expression is negatively correlated with overall survival outcomes in hormone receptor positive breast cancer. Statistical analysis was performed using an unpaired two-tailed Student’s t-test. *compares shCT to shSOP and #compares shSPOP to shSPOP+shGLI3 (*p<0.001 and #p<0.001). SPOP: Speckly-type POZ protein; sh: short hairpin.

Figure 3.
Figure 3.

Comparison of drug sensitivity between shCT and shSPOP cells. Each point represents the average percent viability off three repeats of shCT (x-axis) and shSPOP (y-axis) cells following 48-h treatment with selected compounds. Viability was determined using the MTT assay and normalized to DMSO-treated controls. The grey dashed diagonal line (y=x) denotes equal sensitivity between the two cell lines. Compounds falling below this line are more cytotoxic in shSPOP cells, while those above are more cytotoxic in shCT cells. SPOP: Speckly-type POZ protein; sh: short hairpin.

Figure 4.
Figure 4.

Dose-response curves for gossypol, cyasterone, and spiramycin I. shCT and shSPOP cells were treated with increasing concentrations of each compound for 48 hours, and cell viability was quantified by SRB staining. Data points represent mean±SEM from three independent experiments, and IC50 values were calculated by nonlinear regression. The corresponding chemical structures of each compound are shown below their respective graphs. SPOP: Speckly-type POZ protein; sh: short hairpin.

Figure 5.
Figure 5.

Gossypol inhibits GLI3-dependent SHH signaling in SPOP knockdown cells. Quantitative RT-PCR analysis of SPOP knockdown cells treated with DMSO, gossypol, cyasterone, or spiramycin I. Gene expression levels were normalized to GAPDH and are presented relative to DMSO-treated controls. Data represent mean ± SEM from three independent experiments. Statistical significance was determined using an unpaired two-tailed Student’s t-test (*p<0.001). SPOP: Speckly-type POZ protein.

Figure 6.
Figure 6.

Gossypol inhibits colony formation in SPOP knockdown cells. (A) Representative images from colony formation assays of shCT and shSPOP cells treated with DMSO or gossypol. (B) Quantification of colony numbers. Data represent mean±SEM from three independent assays. Statistical analysis was performed using an unpaired two-tailed Student’s t-test (**p<0.001; *p<0.05). SPOP: Speckly-type POZ protein; sh: short hairpin.

Figure 7.
Figure 7.

Gossypol reverses colony formation in SPOP knockdown cells. (A) Representative images from reverse colony formation assays of shCT and shSPOP. Cells were seeded and allowed to form colonies over 21 days followed by treatment with DMSO or gossypol. (B) Quantification of colony numbers. Data represent mean±SEM from three independent assays. Statistical analysis was performed using an unpaired two-tailed Student’s t-test, **p<0.001; *p<0.05. n.s., Not significant; SEM: standard error of the mean; SPOP: speckly-type POZ protein; sh: short hairpin.

Results

Loss of SPOP increases cell proliferation and GLI3-dependent SHH signaling in breast cancer cells. To investigate the role of SPOP in breast cancer, a stable SPOP knockdown MCF-7 cell line was established using lentiviral shRNA delivery. Knockdown efficiency was validated using qPCR and western blotting (Figure 1a, b). A proliferation assay was then performed which demonstrated that SPOP loss enhances cell proliferation in breast cancer cells (Figure 2a). Given previous findings linking SPOP loss to hyperactivation of GLI3-dependent SHH signaling in prostate cancer (12), the presence of a similar mechanism in breast cancer was investigated. The qPCR results confirmed that SPOP knockdown is associated with increased expression of several GLI3 target genes, which is consistent with activation of GLI3-dependent SHH signaling (Figure 2b). In addition, western blot analysis demonstrated that GLI3 protein levels are elevated upon SPOP knockdown, thus further supporting enhanced GLI3 activity (Figure 2c). To determine if SPOP directly interacts with GLI3 in breast cancer cells, a co-immunoprecipitation assay was performed which revealed a direct interaction between endogenous SPOP and GLI3 (Figure 2d). This interaction supports the model in which GLI3 is a direct substrate of SPOP and suggests that SPOP likely regulates GLI3 stability through its E3 ubiquitin ligase activity. To further confirm the involvement of GLI3, a double knockdown of SPOP and GLI3 was performed. This double knockdown partially rescued the enhanced proliferation and GLI3 target gene expression observed with SPOP knockdown alone thus indicating that GLI3 is required for the SPOP knockdown phenotype (Figure 2a-c). Finally, clinical data showed that low SPOP expression in ER positive, PR positive and HER2 negative breast cancer is correlated with poor overall survival (Figure 2e). Together, these results identify SPOP as a key player in breast cancer where its loss drives activation of GLI3-dependent SHH signaling, enhances proliferation, and correlates with poorer patient outcomes.

Gossypol selectively targets SPOP-deficient breast cancer cells. With the rapid increase of targeted therapies as effective cancer treatments, potential therapeutic vulnerabilities associated with SPOP deficiency in breast cancer were explored. To identify candidate compounds, a focused screen using the DiscoveryProbe natural compound library was performed. A total of 50 compounds were tested in SPOP knockdown and control MCF-7 cells, with treatments consisting of either DMSO or 1 μM compound for 48 h. Cell viability was assessed using an MTT assay, and compounds producing ≥50% differential effect between control and knockdown cells were considered selective hits. A total of four compounds were identified with ≥50% differential effect, with two of these, identified as gossypol and cyasterone, displaying >99% differential selectivity (Figure 3). To further characterize the potency of gossypol and cyasterone, serial dilution SRB assays were conducted, which revealed an IC50 value of ~0.5 μM for gossypol and 1.25 μM for cyasterone (Figure 4; Table I). A serial dilution for spiramycin I was also performed to establish a negative control for further assays (Figure 4; Table I).

View this table:
Table I.

IC50 values for gossypol, cyasterone, and spiramycin I in shCT and shSPOP cells.

Gossypol blocks GLI3-dependent SHH signaling in SPOP-deficient breast cancer cells. As SPOP knockdown cells exhibited hyperactivation of GLI3-dependent SHH signaling, the ability of gossypol and cyasterone to exert their effects through this pathway was investigated. To test this, SPOP-knockdown cells were treated with either DMSO, 0.5 μM gossypol, 1.25 μM cyasterone, or 1 μM spiramycin I followed by qPCR. The results indicated that gossypol significantly suppressed the expression of GLI3 target genes whereas cyasterone and spiramycin I showed insignificant results (Figure 5). These results suggest that gossypol exerts its effects through the GLI3-dependent SHH signaling pathway, while cyasterone affects cell viability through an alternate pathway.

Gossypol affects colony formation in SPOP-deficient breast cancer cells. To evaluate the functional impact of gossypol on breast cancer cells, standard and reverse colony formation assays were conducted. For the standard procedure, cells were seeded at low density and treated with either DMSO or 0.5 μM gossypol. The results showed that gossypol markedly suppressed the growth and clonogenic capacity of the SPOP knockdown cells (Figure 6a, b). By contrast, gossypol treatment did not produce measurable effects in control cells, thus showing its selectivity against the SPOP knockdown background. For the reverse colony formation assay, cells were seeded at low density and allowed to produce colonies before being treated with either DMSO or 0.5 μM gossypol. The results again showed selectivity, with gossypol treatment significantly reversing colony formation in the SPOP knockdown cells while it did not affect the control cells (Figure 7a, b). Collectively, these results indicate that gossypol impairs oncogenic growth specifically under conditions of SPOP loss, potentially through inhibition of GLI3-dependent SHH signaling. Thus, the findings of the current study highlight gossypol as a potential therapeutic candidate for targeting SPOP-downregulated breast cancer.

Discussion

The present study uncovered a previously uncharacterized role of SPOP loss in breast cancer and highlighted a potential therapeutic opportunity associated with this alteration. Downregulation of SPOP, which occurs in a significant proportion of breast tumors, was shown to promote cell proliferation through hyperactivation of GLI3-dependent SHH signaling. These findings extend prior research in prostate cancer, where SPOP mutations stabilize GLI3 and activate SHH signaling, suggesting that a similar oncogenic mechanism may operate in breast cancer (12).

To identify therapeutic vulnerabilities arising from this pathway, the natural compounds gossypol and cyasterone were evaluated in SPOP-deficient cells. Gossypol is a sesquiterpenoid phytoalexin produced by plants of the genus Gossypium as part of their natural defense system against biotic stresses, including pathogen infection and herbivory (23). While its primary role lies in plant protection, gossypol has also attracted considerable attention due to its potential biomedical and industrial applications. Its diverse pharmacological properties, ranging from contraceptive and anticancer activity to antiviral, antiparasitic and antimicrobial effects, have made it a compound of ongoing interest across multiple research fields (23). It is noteworthy that gossypol has previously been shown to target SHH signaling synergistically with arsenic trioxide in glioma stem cell-like cells (24). Furthermore, gossypol has also shown to inhibit proliferation of breast pre-adipocytes (25). Cyasterone, a compound derived from Achyranthes bidentata, has been reported to promote osteoblast differentiation, inhibit EGFR signaling, and induce apoptosis, although no connection to breast cancer or SHH signaling had been established (26-28). In the present study, gossypol significantly reduced GLI3 target gene expression and reversed the proliferative advantage associated with SPOP knockdown, whereas cyasterone exhibited minimal impact on SHH signaling. These results suggest that gossypol acts through GLI3-dependent mechanisms, while cyasterone likely affects cell viability through alternate pathways.

The identification of gossypol as a selective inhibitor of SPOP-deficient breast cancer cells represents a noteworthy advancement. Beyond suppressing GLI3 target gene expression, gossypol impaired clonogenic growth in SPOP-deficient cells, indicating both mechanistic and functional relevance. Its selective effect suggests potential for reduced toxicity in therapeutic settings, a common limitation of conventional chemotherapies. Given previous evidence that gossypol blocks SHH signaling in glioma models, the present findings position gossypol as a promising candidate for development as a GLI3-targeted therapy in breast cancer (24).

Taken together, these findings support the growing recognition that breast cancer subtypes defined by molecular alterations, such as SPOP loss, may benefit from precision-medicine strategies. Additionally, they provide proof-of-concept that natural compounds can selectively target signaling vulnerabilities in breast cancer, supporting broader efforts to expand drug-discovery pipelines beyond synthetic agents. Finally, the results raise the possibility that gossypol could be combined with existing treatment regimens, particularly for patients with SPOP-downregulated tumors, to enhance therapeutic efficacy and reduce adverse effects.

Conclusion

In conclusion, this study identifies SPOP loss as a driver of GLI3-dependent SHH hyperactivation in breast cancer and demonstrates that gossypol selectively suppresses the oncogenic potential of SPOP-deficient cells. These findings enhance our understanding of the molecular consequences of SPOP loss and nominate gossypol as a promising candidate therapeutic for a defined subset of breast cancer patients. Continued preclinical and clinical studies will be essential to evaluate the specificity, efficacy, and translational impact of gossypol-based therapies in breast cancers characterized by SPOP downregulation.

Footnotes

  • Authors’ Contributions

    M.B. conceived and supervised the study. M.B. designed the methodology and provided resources. P.A. and J.C. performed the experiments and data curation. All authors conducted formal analysis. M.B. wrote the original draft, and all authors contributed to review and editing of the manuscript. All Authors approved the final version of the paper.

  • Conflicts of Interest

    The Authors declare that they have no conflicts of interest.

  • Funding

    This research received no external funding.

  • Artificial Intellegince (AI) Disclosure

    No artificial intelligence (AI) tools, including large language models or machine learning software, were used in the preparation, analysis, or presentation of this manuscript.

  • Received February 10, 2026.
  • Revision received March 5, 2026.
  • Accepted March 24, 2026.

This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.

References

  1. ↵
    1. Siegel RL,
    2. Kratzer TB,
    3. Giaquinto AN,
    4. Sung H,
    5. Jemal A
    : Cancer statistics, 2025. CA Cancer J Clin 75(1): 10-45, 2025. DOI: 10.3322/caac.21871
    OpenUrlCrossRefPubMed
  2. ↵
    1. Berardi D,
    2. Hunter Y,
    3. van den Driest L,
    4. Farrell G,
    5. Rattray NJW,
    6. Rattray Z
    : The differential metabolic signature of breast cancer cellular response to olaparib treatment. Cancers (Basel) 14(15): 3661, 2022. DOI: 10.3390/cancers14153661
    OpenUrlCrossRefPubMed
    1. Chang HR,
    2. Glaspy J,
    3. Allison MA,
    4. Kass FC,
    5. Elashoff R,
    6. Chung DU,
    7. Gornbein J
    : Differential response of triple-negative breast cancer to a docetaxel and carboplatin-based neoadjuvant treatment. Cancer 116(18): 4227-4237, 2010. DOI: 10.1002/cncr.25309
    OpenUrlCrossRefPubMed
  4. ↵
    1. Reynolds DS,
    2. Tevis KM,
    3. Blessing WA,
    4. Colson YL,
    5. Zaman MH,
    6. Grinstaff MW
    : Breast cancer spheroids reveal a differential cancer stem cell response to chemotherapeutic treatment. Sci Rep 7(1): 10382, 2017. DOI: 10.1038/s41598-017-10863-4
    OpenUrlCrossRefPubMed
  5. ↵
    1. Neves Rebello Alves L,
    2. Dummer Meira D,
    3. Poppe Merigueti L,
    4. Correia Casotti M,
    5. do Prado Ventorim D,
    6. Ferreira Figueiredo Almeida J,
    7. Pereira de Sousa V,
    8. Cindra Sant’Ana M,
    9. Gonçalves Coutinho da Cruz R,
    10. Santos Louro L,
    11. Mendonça Santana G,
    12. Erik Santos Louro T,
    13. Evangelista Salazar R,
    14. Ribeiro Campos da Silva D,
    15. Stefani Siqueira Zetum A,
    16. Silva Dos Reis Trabach R,
    17. Imbroisi Valle Errera F,
    18. de Paula F,
    19. de Vargas Wolfgramm Dos Santos E,
    20. Fagundes de Carvalho E,
    21. Drumond Louro I
    : Biomarkers in breast cancer: an old story with a new end. Genes (Basel) 14(7): 1364, 2023. DOI: 10.3390/genes14071364
    OpenUrlCrossRefPubMed
  6. ↵
    1. Waks AG,
    2. Winer EP
    : Breast cancer treatment: a review. JAMA 321(3): 288, 2019. DOI: 10.1001/jama.2018.19323
    OpenUrlCrossRefPubMed
  7. ↵
    1. Li C,
    2. Ao J,
    3. Fu J,
    4. Lee DF,
    5. Xu J,
    6. Lonard D,
    7. O’Malley BW
    : Tumor-suppressor role for the SPOP ubiquitin ligase in signal-dependent proteolysis of the oncogenic co-activator SRC-3/AIB1. Oncogene 30(42): 4350-4364, 2011. DOI: 10.1038/onc.2011.151
    OpenUrlCrossRefPubMed
  8. ↵
    1. Wei C,
    2. Liu Y,
    3. Liu X,
    4. Cheng J,
    5. Fu J,
    6. Xiao X,
    7. Moses RE,
    8. Li X,
    9. Fu J
    : The speckle-type POZ protein (SPOP) inhibits breast cancer malignancy by destabilizing TWIST1. Cell Death Discov 8(1): 389, 2022. DOI: 10.1038/s41420-022-01182-3
    OpenUrlCrossRefPubMed
  9. ↵
    1. Xu L,
    2. Wei Y,
    3. Reboul J,
    4. Vaglio P,
    5. Shin TH,
    6. Vidal M,
    7. Elledge SJ,
    8. Harper JW
    : BTB proteins are substrate-specific adaptors in an SCF-like modular ubiquitin ligase containing CUL-3. Nature 425(6955): 316-321, 2003. DOI: 10.1038/nature01985
    OpenUrlCrossRefPubMed
  10. ↵
    1. Zhuang M,
    2. Calabrese MF,
    3. Liu J,
    4. Waddell MB,
    5. Nourse A,
    6. Hammel M,
    7. Miller DJ,
    8. Walden H,
    9. Duda DM,
    10. Seyedin SN,
    11. Hoggard T,
    12. Harper JW,
    13. White KP,
    14. Schulman BA
    : Structures of SPOP-substrate complexes: insights into molecular architectures of BTB-Cul3 ubiquitin ligases. Mol Cell 36(1): 39-50, 2009. DOI: 10.1016/j.molcel.2009.09.022
    OpenUrlCrossRefPubMed
  11. ↵
    1. Clark A,
    2. Burleson M
    : SPOP and cancer: a systematic review. Am J Cancer Res 10(3): 704-726, 2020.
    OpenUrlPubMed
  12. ↵
    1. Burleson M,
    2. Deng JJ,
    3. Qin T,
    4. Duong TM,
    5. Yan Y,
    6. Gu X,
    7. Das D,
    8. Easley A,
    9. Liss MA,
    10. Yew PR,
    11. Bedolla R,
    12. Kumar AP,
    13. Huang TH,
    14. Zou Y,
    15. Chen Y,
    16. Chen CL,
    17. Huang H,
    18. Sun LZ,
    19. Boyer TG
    : GLI3 is stabilized by SPOP mutations and promotes castration resistance via functional cooperation with androgen receptor in prostate cancer. Mol Cancer Res 20(1): 62-76, 2022. DOI: 10.1158/1541-7786.mcr-21-0108
    OpenUrlAbstract/FREE Full Text
  13. ↵
    1. Schwend T,
    2. Jin Z,
    3. Jiang K,
    4. Mitchell BJ,
    5. Jia J,
    6. Yang J
    : Stabilization of speckle-type POZ protein (Spop) by Daz interacting protein 1 (Dzip1) is essential for Gli turnover and the proper output of Hedgehog signaling. J Biol Chem 288(45): 32809-32820, 2013. DOI: 10.1074/jbc.M113.512962
    OpenUrlAbstract/FREE Full Text
    1. Wang C,
    2. Pan Y,
    3. Wang B
    : Suppressor of fused and Spop regulate the stability, processing and function of Gli2 and Gli3 full-length activators but not their repressors. Development 137(12): 2001-2009, 2010. DOI: 10.1242/dev.052126
    OpenUrlAbstract/FREE Full Text
  15. ↵
    1. Cai H,
    2. Liu A
    : Spop regulates Gli3 activity and Shh signaling in dorsoventral patterning of the mouse spinal cord. Dev Biol 432(1): 72-85, 2017. DOI: 10.1016/j.ydbio.2017.04.002
    OpenUrlCrossRefPubMed
  16. ↵
    1. Katano M
    : Hedgehog signaling pathway as a therapeutic target in breast cancer. Cancer Lett 227(2): 99-104, 2005. DOI: 10.1016/j.canlet.2004.11.030
    OpenUrlCrossRefPubMed
    1. Onishi H,
    2. Katano M
    : Hedgehog signaling pathway as a therapeutic target in various types of cancer. Cancer Sci 102(10): 1756-1760, 2011. DOI: 10.1111/j.1349-7006.2011.02010.x
    OpenUrlCrossRefPubMed
    1. Iriana S,
    2. Asha K,
    3. Repak M,
    4. Sharma-Walia N
    : Hedgehog signaling: implications in cancers and viral infections. Int J Mol Sci 22(3): 1042, 2021. DOI: 10.3390/ijms22031042
    OpenUrlCrossRefPubMed
  19. ↵
    1. Cierpikowski P,
    2. Lis-Nawara A,
    3. Bar J
    : SHH expression is significantly associated with cancer stem cell markers in oral squamous cell carcinoma. Anticancer Res 41(11): 5405-5413, 2021. DOI: 10.21873/anticanres.15352
    OpenUrlAbstract/FREE Full Text
  20. ↵
    1. Herranz-López M,
    2. Losada-Echeberría M,
    3. Barrajón-Catalán E
    : The multitarget activity of natural extracts on cancer: synergy and xenohormesis. Medicines (Basel) 6(1): 6, 2018. DOI: 10.3390/medicines6010006
    OpenUrlCrossRefPubMed
  21. ↵
    1. Zhang Y,
    2. Li H,
    3. Zhang J,
    4. Zhao C,
    5. Lu S,
    6. Qiao J,
    7. Han M
    : The combinatory effects of natural products and chemotherapy drugs and their mechanisms in breast cancer treatment. Phytochem Rev 19(5): 1179-1197, 2020. DOI: 10.1007/s11101-019-09628-w
    OpenUrlCrossRef
  22. ↵
    1. Debnath I,
    2. Kundu M
    : Therapeutic potential of natural compounds in targeting cancer stem cells: a promising approach for cancer treatment. Discov Oncol 16(1): 1433, 2025. DOI: 10.1007/s12672-025-03190-y
    OpenUrlCrossRefPubMed
  23. ↵
    1. Sharma K,
    2. Kumar M,
    3. Dukare A,
    4. Vigneshwaran N,
    5. Thappa C,
    6. Saxena S,
    7. Pandiyan K,
    8. D’Souza C,
    9. Singh R
    : Gossypol and semisynthetic derivatives: chemistry, bioactivities, and mechanism of actions. Chem Biodivers 22(8): e202402872, 2025. DOI: 10.1002/cbdv.202402872
    OpenUrlCrossRefPubMed
  24. ↵
    1. Linder B,
    2. Wehle A,
    3. Hehlgans S,
    4. Bonn F,
    5. Dikic I,
    6. Rödel F,
    7. Seifert V,
    8. Kögel D
    : Arsenic trioxide and (−)-gossypol synergistically target glioma stem-like cells via inhibition of Hedgehog and notch signaling. Cancers (Basel) 11(3): 350, 2019. DOI: 10.3390/cancers11030350
    OpenUrlCrossRefPubMed
  25. ↵
    1. Zhong S,
    2. Leong J,
    3. Ye W,
    4. Xu P,
    5. Lin SH,
    6. Liu JY,
    7. Lin YC
    : (−)-Gossypol-enriched cottonseed oil inhibits proliferation and adipogenesis of human breast pre-adipocytes. Anticancer Res 33(3): 949-955, 2013.
    OpenUrlAbstract/FREE Full Text
  26. ↵
    1. Lu X,
    2. Qiu H,
    3. Yang L,
    4. Zhang J,
    5. Ma S,
    6. Zhen L
    : RETRACTED: Anti-proliferation effects, efficacy of cyasterone in vitro and in vivo and its mechanism. Biomed Pharmacother 84: 330-339, 2016. DOI: 10.1016/j.biopha.2016.09.041
    OpenUrlCrossRefPubMed
    1. Sun Y,
    2. Liang M,
    3. Xing Y,
    4. Duan Y,
    5. Zhang S,
    6. Deng B,
    7. Xiang X,
    8. Zhou B
    : Cyasterone has a protective effect on steroid-induced Osteonecrosis of the femoral head. PLoS One 18(10): e0293530, 2023. DOI: 10.1371/journal.pone.0293530
    OpenUrlCrossRefPubMed
  28. ↵
    1. Zhu J,
    2. Liu Y,
    3. Chen C,
    4. Chen H,
    5. Huang J,
    6. Luo Y,
    7. Zhao K,
    8. Chen D,
    9. Xu Z,
    10. Li W,
    11. Zhang X,
    12. Xiong Y,
    13. Xu L,
    14. Wang B
    : Cyasterone accelerates fracture healing by promoting MSCs migration and osteogenesis. J Orthop Translat 28: 28-38, 2021. DOI: 10.1016/j.jot.2020.11.004
    OpenUrlCrossRefPubMed
Back to top

In this issue

Print
Download PDF
Article Alerts
Email Article
Citation Tools
Reprints and Permissions
Gossypol Inhibits GLI3-dependent SHH Signaling to Selectively Target SPOP-deficient Breast Cancer Cells
PATRICIA AUGUSTINE, JAZMIN CHAVARRIA, MARIEKE BURLESON
Anticancer Research May 2026, 46 (5) 2317-2327; DOI: 10.21873/anticanres.18119
Twitter logo Facebook logo Mendeley logo

Jump to section

Keywords