Research ArticleExperimental Studies
Open Access

The miR-29b Byproduct MIRTX Shows Superior Anti-tumor Activity, Compared to miR-29b-3p, in Pancreatic Cancer Cells

YUHKI YOKOYAMA, AKIRA INOUE, HIROYUKI YAMAMOTO, SHIHORI KOUDA, YUMA IRIE, RUIJIA YANG, YINGJUE ZHANG, MANAMI TSUJIMOTO, NANAMI NAGATA, YOSHIHIRO MORIMOTO, TSUYOSHI HATA, DAISUKE OKUZAKI, SATOSHI SHIBATA, HIROFUMI YAMAMOTO and MASAKI MORI
Anticancer Research February 2026, 46 (2) 619-632; DOI: https://doi.org/10.21873/anticanres.17974

Abstract

Background/Aim: Pancreatic cancer has a poor prognosis, with a 5-year survival rate of only 9%. Thus, there is an urgent need to develop effective cancer therapeutics for this disease. It is expected that nucleic acid therapeutics will be a next-generation cancer treatment. We previously reported that MIRTX – a complementary strand of miR-29b-1-5p (the passenger sequence of miR-29b) – exerts strong anti-tumor effects in colorectal cancer cells. Here we investigated the anti-tumor effects of MIRTX, compared to those of the guide sequence of miR-29b (miR-29b-3p), in pancreatic cancer cells.

Materials and Methods: We evaluated how treatment with MIRTX and miR-29b-3p affected cell proliferation, cell cycle, apoptosis, and invasion in pancreatic cancer cell lines (Panc-1, SUIT-2, and BxPC-3). We also performed RNA-seq and in silico analyses to explore novel target genes of MIRTX.

Results: Compared to miR-29b-3p, MIRTX strongly suppressed cell proliferation and invasion, delayed cell cycle progression, and induced apoptosis in pancreatic cancer cells. RNA-seq and in silico prediction identified the genes encoding cyclin A2, cyclin B2, and NCAPD3 as potential candidate targets of MIRTX.

Conclusion: MIRTX is a potential therapeutic miRNA in pancreatic cancer cells.

Keywords:

Introduction

Pancreatic cancer has a poor prognosis, with a 5-year survival rate of only 9%. It is responsible for 467,005 cancer deaths per year globally and was ranked sixth for mortality in 2022 (1). The currently available therapeutic options for pancreatic cancer include FOLFIRINOX (5-fluorouracil, leucovorin, irinotecan, and oxaliplatin) with or without PARP inhibitors and nab-paclitaxel plus gemcitabine (2). However, these treatments have only minimal efficacy. KRAS mutations are found in the majority (95%) of pancreatic cancer cases (3). Although the KRAS protein is considered an undruggable target, the KRAS G12C inhibitor sotorasib has recently been approved as a cancer drug, by the U.S. Food and Drug Administration (FDA) (4). However, the KRAS G12C mutation occurs in only 1-2% of pancreatic cancers (5). Thus, there is an urgent need to develop new effective cancer therapeutics for pancreatic cancer.

It is expected that nucleic acid therapeutics will be part of the next generation of cancer therapies. The present study focused on microRNAs (miRNAs), which are single-stranded RNA molecules involved in the post-transcriptional regulation of gene expression. A double-stranded precursor miRNA with a loop structure is transcribed and then transformed into a mature miRNA by Drosha and Dicer. From the precursor miRNA, one strand (passenger strand) is degraded, and the other (guide strand) binds to the 3′ untranslated region (UTR) of the target mRNA, thereby inhibiting translation (6, 7). Notably, miRNAs and mRNAs bind with incomplete homology, allowing miRNAs to bind and regulate multiple genes (8-10).

MiRNA-29b comprises the miR-29b-3p strand and miR-29b-1-5p strand, which interact with each other and form a loop structure. We previously demonstrated that miR-29b-3p suppressed cell proliferation, and the expression of anti-apoptotic protein MCL-1 and cell cycle-related protein CDK6, in colorectal cancer cells (11). On the other hand, the passenger strand miR-29b-1-5p was considered to be inactive and degraded in vivo (12). Interestingly, we found that the complementary strand of miR-29b-1-5p exerts strong anti-tumor effects in colorectal cancer cells, and we named this sequence MIRTX (12). The homology of the MIRTX and miR-29b-3p sequences is 62.5%, with completely distinct seed sequences (2-8 bp from 5′-end), suggesting that MIRTX and miR-29b-3p may exhibit anti-tumor effects through different molecular mechanisms.

In the present study, we investigated whether these miRNAs exert anti-tumor effects in pancreatic cancer cells. Our results suggest that MIRTX could be a promising therapeutic miRNA for pancreatic cancer.

Materials and Methods

Cell culture. All cells were obtained from American Type Culture Collection (ATCC). The human pancreatic cancer cell lines SUIT-2 and BxPC-3 were cultured in RPMI 1640 (Thermo Fisher Scientific, Inc., Waltham, MA, USA), containing 10% fetal bovine serum (FBS; Biowest, Nuaillé, France) and Penicillin-Streptomycin Mixed Solution (Nacalai Tesque, Inc., Kyoto, Japan). The human pancreatic cancer cell line Panc-1 was cultured in DMEM (Thermo Fisher Scientific, Inc.), containing 10% FBS and Penicillin-Streptomycin Mixed Solution. All cells were cultured at 37°C under 5% CO2. The cell lines were authenticated by morphological inspection, short tandem repeat profiling, and mycoplasma testing.

Transfection of miRNA. Cells were transfected with miRNA using Lipofectamine RNAiMAX reagent (Thermo Fisher Scientific, Inc.), at a final concentration of 30 nM, following the manufacturer’s protocol. All miRNAs used in this study were obtained from GeneDesign, Inc. (Osaka, Japan). The miRNA sequences were as follows: miR-29b-3p, S: 5′-UAGCACCAUUUGAAAUCAGUGUU-3′, AS: 5′-AACACUGAUUUCAAAUGGUGCUA-3′; MIRTX, S: 5′-UCUAAACCACCAUAUGAAACCAGC-3′, AS: 5′-GCUGGUUUCAUAUGGUGGUUUAGA-3′; and negative control RNA (NC), S: 5′-AUCCGCGCGAUAGUACGUA-3′, AS: 5′-UACGUACUAUCGCGCGGAU-3′.

Western blotting. Cells were lysed in RIPA buffer (0.05 M Tris-HCl pH 7.6, 0.15 M NaCl, 1% Nonidet P-40, and 0.5% sodium deoxycholate) containing proteinase inhibitor and phosphatase inhibitor. The cell lysate was subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then transferred to a polyvinylidene difluoride membrane (Merck Millipore, Burlington, MA, USA). The following primary antibodies were used in this study: anti-b-actin antibody (1:1,000; Cell Signaling Technology, Danvers, MA, USA), anti-BCL-2 antibody (1:1,000; Abcam, Cambridge, UK), anti-BCL-xL antibody (1:1,000; Cell Signaling Technology), anti-MCL-1 antibody (1:1,000; Cell Signaling Technology), anti-Survivin antibody (1:1,000; Cell Signaling Technology), anti-cleaved caspase 3 antibody (1:1,000; Cell Signaling Technology), anti-cleaved PARP antibody (1:1,000; Cell Signaling Technology), anti-CDK4 antibody (1:1,000; Santa Cruz, Dallas, TX, USA), anti-CDK6 antibody (1:1,000; Sigma Aldrich), anti-cyclin D1 antibody (1:1,000; Cell Signaling Technology), anti-Cdc2 antibody (1:1,000; Cell Signaling Technology), anti-phospho-Cdc2 (Tyr15) (p-Cdc2) antibody (1:1,000; Cell Signaling Technology), anti-Rb antibody (1:1,000; Abcam), anti-p21WAF1/CIP1 antibody (1:500; Abcam), p27KIP1 antibody (1:1,000; Abcam), anti-cyclin A2 antibody (1:2,000; Cell Signaling Technology), and anti-cyclin B2 antibody (1:500; Abcam). Bands were detected using the ImageQuant LAS 4000mini (GE Healthcare, Chicago, IL, USA).

Quantitative RT-PCR. Cells were lysed in TRIzol regent (Thermo Fisher Scientific, Inc.), and total RNA was extracted following the standard protocol. From this RNA, complementary DNA was generated using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, Inc.). We performed qPCR using the LightCycler 480 System II (Roche Diagnostics, Rotkreuz, Switzerland), and quantified relative expression using the ΔΔCt method. Each value was normalized to GAPDH expression. Primer sequences are as follows:

Primer sequences for qRT-PCR (5′-3′): GAPDH_F: CAACTACATGGTTTACATGTTC; GAPDH_R: GCCAGTGG ACTCCACGAC; NCAPH_F: AAACACGCAGATTACGGAACA; NCAPH_R: GTTGGTTGGTTCGGTGTCTTT; NCAPH2_F: TTCTTTTGACGAAGGCAAGACC; NCAPH2_R: GACGA GTGAGTAGAGGTATTCCA; NCAPD2_F: CCACTCGGGA AGCCATAACAC; NCAPD2_R: CGCCTGCAACCAGTACAGG; NCAPD3_F: GTGGGGAATACGCTATGTTCATT; NCAPD3_R: CATCAAGAGTAAAAACCCGGTGT; NCAPG_F: GAGG CTGCTGTOGATTAAGGA; NCAPG_R AACTGTCTTATC ATCCATCGTGC; NCAPG2_F AAACCGAACATGGCTCAAAAATG; NCAPG2_R: GGCTTCGTAGTTCTCACTTTCA; SMC2_F: AACTCTTGCTGGTCAAATGATGG; SMC2_R: TTGATCCTTC CTGTAGCCACTA; SMC4_F: TTGTCATGCACTGGACTACATTG; SMC4_R: TTTTTCGCCCATACAGCCATC.

WST assay. Cell proliferation was assessed using the WST-1 assay. A total of 3.0-4.0×103 cells were plated in 96-well plates, and then treated with miRNA. To each well, we added 10 μl of Cell Counting Kit solution (Dojindo Molecular Technologies, Inc., Kumamoto, Japan), at 24, 48, and 72 h after transfection. Plates were incubated for 2 h in the dark at 37°C, and then the absorbance was detected using a Multiskan Go plate reader (Thermo Fisher Scientific, Inc.).

Matrigel invasion assay. Invasive activity was assessed using Corning BioCoat Matrigel Invasion Chambers (pore size: 8.0 μm; Corning, Inc., Corning, NY, USA). The upper chamber was precoated with Matrigel and then rehydrated using the appropriate culture medium (RPMI1640 or DMEM) for 2 h, at 37°C in 5% CO2. Next, the medium was removed, and the upper chamber was seeded with Panc-1, SUIT-2, or BxPC-3 cells at a density of 7.5×104 cells per chamber, in the appropriate medium containing 0.1% bovine serum albumin. Medium containing 10% FBS was added to the lower wells. Cells were transfected with the miRNAs, then incubated at 37°C. After incubation for 48 or 72 h, the invaded cells were fixed with 10% formalin for 1 h at room temperature and then stained with hematoxylin for 1 h at room temperature. To count the invaded cells, images were captured using a bright-field light microscope (CKX53; Olympus Corporation, Tokyo, Japan) with a Visualix camera (Visualix Inc., Kobe, Japan).

Cell cycle assay. Cells were seeded in 6well plates, at a density of 3.5×105 cells per well and were then starved for 48 h in serumfree medium (RPMI1640 or DMEM). After 24 h of starvation, the cells were transfected with miRNAs. Cells were collected at 24 and 48 h and fixed in 70% ethanol for 30 min at 4°C. The fixed cells were washed twice with PBS and then incubated with RNase (Sigma Aldrich) for 20 min at 37°C. Cells were treated with propidium iodide (Dojindo Molecular Technologies, Inc.) for 20 min on ice. Finally, flow cytometry analysis was performed using a Spectral Analyzer SA3800 (Sony Biotechnology, Inc., Tokyo, Japan) with SA3800 2.0 software (Sony Biotechnology, Inc.).

Annexin V assay. A total of 2.0×105 cells were plated and treated with miRNAs. The treated cells were suspended and stained using the Alexa Fluor 488 Annexin V/Dead Cell Apoptosis Kit (Thermo Fisher Scientific, Inc.), following the manufacturer’s protocol. The apoptotic cell population was assessed by flow cytometry using a Spectral Analyzer SA3800.

TUNEL assay. Sterile glass cover slips (15-mm-diameter) were placed on 6-well plates, and then these glass cover slips were seeded with 2.0×105 cells. The next day, the cells were transfected with miRNAs. At 48 h after transfection, the cells were washed with PBS and then fixed with 4% PFA for 25 min at 4°C. Next, the cells were washed twice with PBS and permeabilized with 0.2% TritonX-100 reagent for 5 min at room temperature. Finally, the cells were stained using the TUNEL assay kit (Promega, Madison, WI, USA), following the manufacturer’ s protocol.

RNA sequencing. RNA sequencing was performed as previously described (13). The library was prepared using a TruSeq Stranded mRNA Sample Prep Kit (Illumina, San Diego, CA, USA), and then sequencing was performed using the Illumina HiSeq 2500 platform in 75-base single-end mode. Base calling was performed using Illumina Casava 1.8.2 software, and the sequenced reads were mapped to human reference genome sequences (hg19) using TopHat version 2.0.13, combined with Bowtie2 version 2.2.3 and SAMtools version 0.1.19. Cuffnorm version 2.2.1 was used to calculate the fragments per kilobase of exon per million mapped fragments (FPKM).

Data analysis. Data were analyzed using TargetScan (http://www.targetscan.org/), miRBase (http://www.mirbase.org/), iDEP (http://bioinformatics.sdstate.edu/idep/), and Cancer Cell Line Encyclopedia (CCLE; https://sites.broadinstitute.org/ccle/).

Statistical analysis. All data are reported as mean±standard deviation. Student’s t-test was used to calculate statistical significance. For multiple comparisons, statistical significance was calculated using one-way ANOVA, followed by Tukey’s test. All experiments were performed in triplicate. A p-value of <0.05 was considered significant.

Results

Study design. A flowchart of this study is shown in Figure 1.

Figure 1.
Figure 1.

Flowchart of this study.

MIRTX suppresses cell proliferation and invasion of pancreatic cancer cells. To investigate the anti-tumor effects of MIRTX and miR-29b-3p in pancreatic cancer cells, both miRNAs were transfected into the KRAS mutant pancreatic cancer cell lines Panc-1 and SUIT-2, and the KRAS wild-type pancreatic cancer cell line BxPC-3. Compared with miR-29b-3p, MIRTX strongly suppressed cell proliferation in all tested pancreatic cancer cell lines (Figure 2). We also performed the Matrigel invasion assay to examine the effects of MIRTX and miR-29b-3p on invasive activity. Compared with miR-29b-3p, MIRTX more strongly suppressed the invasive activity of all tested pancreatic cancer cells (Figure 3).

Figure 2.
Figure 2.

Effects of miR-29b-3p and MIRTX on cell proliferation in pancreatic cancer cell lines. (A) Images of cells at 72 h after miRNA treatment. 100× magnification. (B) MIRTX treatment suppressed cell proliferation in Panc-1, SUIT-2, and BxPC-3 cells. All experiments were performed in triplicate. All data are presented as the mean±SD. **p<0.01. NC, Negative control; N.S., not significant.

Figure 3.
Figure 3.

Effects of miR-29b-3p and MIRTX on invasive activity in pancreatic cancer cell lines. (A) Pictures of invaded cells at 48 h (Panc-1 and BxPC-3) or 72 h (SUIT-2) after miRNA treatment. 400× magnification. (B) MIRTX treatment suppressed the invasive activity of Panc-1, SUIT-2, and BxPC-3 cells. Cells were seeded at a density of 7.5×104 cells/chamber, and the invaded cells were counted at 48 h (Panc-1 and BxPC-3) or 72 h (SUIT-2) after transfection. All experiments were performed in triplicate. All data are presented as the mean±SD. *p<0.05. **p<0.01. NC, Negative control.

MIRTX induces apoptosis and delays cell cycle progression in pancreatic cancer cells. Next, we examined how MIRTX and miR-29b-3p affected apoptosis and cell cycle progression in the pancreatic cancer cell lines. Compared with miR-29b-3p, MIRTX strongly induced apoptosis and suppressed expression of the anti-apoptotic proteins MCL-1 and Survivin (Figure 4). Cell cycle analysis revealed that cell cycle progression in the pancreatic cancer cells was delayed by both MIRTX and miR-29b-3p, but especially by MIRTX (Figure 5A and B). Notably, MIRTX treatment suppressed the expression of proteins related to the cell cycle, such as CDK4, CDK6, CDC2, and p-CDC2, and increased p21 expression (Figure 5C).

Figure 4.
Figure 4.
Figure 4.

Proapoptotic effects of miR-29b-3p and MIRTX in pancreatic cancer cell lines. (A) Representative images of the annexin V assay. Percentages indicate the sum of early and late apoptotic cells. (B) MIRTX treatment (48 h) induced apoptosis in Panc-1, SUIT-2, and BxPC-3 cells. Early apoptotic cells were considered to be annexin V (AF488)-positive and propidium iodide (PI)-negative. Late apoptotic cells were considered to be annexin V-positive and PI-positive. (C) MIRTX treatment (48 h) increased the number of TUNEL-positive cells among pancreatic cell lines. (D) MIRTX treatment (48 h) suppressed expression of the anti-apoptotic proteins MCL-1 and Survivin, and increased the apoptotic markers cleaved-caspase 3 (C-Caspase 3) and cleaved-PARP (C-PARP). Actin was used as a loading control. All experiments were performed in triplicate. All data are presented as the mean±SD. *p<0.05. **p<0.01.

Figure 5.
Figure 5.

Effects of miR-29b-3p and MIRTX on the cell cycle and expression of cell-cycle-related molecules in pancreatic cancer cell lines. (A, B) MIRTX treatment delayed cell cycle progression in Panc-1, SUIT-2, and BxPC-3 cells at 24 h (A) and 48 h (B). (C) MIRTX treatment (48 h) suppressed the expression of proteins related to the cell cycle (CDK4, CDK6, CDC2, and p-CDC2) and increased p21 expression.

Cyclin A2, cyclin B2, and the condensin complex are potential targets of MIRTX. We performed RNA-seq to identify new potential targets of MIRTX. Since our results suggested that the effects of MIRTX were detectable at 24-48 h after treatment, and Panc-1 showed a representative phenotype against MIRTX, we compared gene expression between control cells and MIRTX-treated Panc-1 cells after 36 h. Gene Ontology analysis revealed that MIRTX treatment significantly altered the expression of genes involved in the cell cycle (237 genes), mitotic cell cycle process (156 genes), cell cycle process (196 genes), the mitotic cell cycle (165 genes), and chromosome organization (167 genes) (Figure 6A). These findings are consistent with the observation that MIRTX treatment induced cell cycle arrest in pancreatic cells. We previously identified 1043 genes with the MIRTX seed sequence as a binding site (12). Among these genes, we focused on those encoding cyclin A2 and cyclin B2, because both are associated with the cell cycle and exhibited downregulated expression upon MIRTX treatment. We additionally focused on the condensin complex, because it plays important functions in mitosis and chromosome organization, and because one of its components, NCAPD3, possesses the MIRTX seed sequence binding site.

Figure 6.
Figure 6.

Effects of miR-29b-3p and MIRTX on the expression of cyclin A2, cyclin B2, and condensin complex molecules in pancreatic cancer cell lines. (A) Results of Gene Ontology analysis. MIRTX treatment significantly altered the expression of genes associated with cell cycle, mitotic cell cycle process, cell cycle process, mitotic cell cycle, and chromosome organization. (B) MIRTX treatment (48 h) suppressed cyclin A2 and cyclin B2 protein expression. (C) RNA sequencing results. MIRTX treatment (36 h) suppressed expression of components of the condensin complex in Panc-1 cells. (D-F) MIRTX treatment (24 h) suppressed the mRNA expression of components of the condensin complex. All experiments were performed in triplicate. All data are presented as the mean±SD. *p<0.05, **p<0.01.

MIRTX treatment decreased cyclin A2 and cyclin B2 protein expression in the tested pancreatic cancer cells (Figure 6B). Moreover, MIRTX treatment of the pancreatic cancer cells led to suppression of not just NCAPD3, but all components of the condensin complex (Figure 6C-F).

Discussion

MiRNAs are involved in the post-transcriptional regulation of gene expression. There are two types of miRNAs; tumor-suppressive miRNAs and oncogenic miRNAs (onco-miRs) that promote tumor malignancy, including invasion and drug resistance (14-16). They have been extensively studied for their potential use in cancer therapy, because they can bind multiple target genes and demonstrate antitumor effects in a multimolecular regulatory manner (17). We previously reported that MIRTX, a byproduct of miR-29b-1-5p, exerts strong anti-tumor effects in colorectal cancer cells. Here we investigated the anti-tumor effects of MIRTX in pancreatic cancer cells.

Our previous study demonstrated that MIRTX suppressed KRAS expression in colorectal cancer cells, indicating that the anti-tumor activity of MIRTX may be at least partly dependent on KRAS-driven oncogenic signaling. This suggests MIRTX therapy as a potentially promising strategy for pancreatic cancer treatment, since most pancreatic cancers harbor KRAS mutations. Interestingly, our present results showed that the apoptotic and cell-cycle inhibitory effects of MIRTX appeared to be less pronounced in the KRAS wild-type BxPC-3 cells, compared to in the KRAS-mutant Panc-1 and SUIT-2 cells. Further experiments using KRAS-overexpression or isogenic cell lines are needed to verify this association.

We previously reported that MIRTX treatment of colorectal cancer cells markedly inhibited cell proliferation and invasive activity, and induced apoptosis. In silico analysis using TargetScan revealed that MIRTX binds to both PI3K and the inflammatory chemokine receptor CXCR2, suppressing their downstream signaling. These molecules play important roles in cell proliferation and invasion. Moreover, in colorectal cancer cells, MIRTX suppressed not only CXCR2 and PI3K, but also other signaling genes (including KRAS and NF-κB, which play important roles in cancer survival and growth), and anti-apoptotic proteins (including MCL-1, BCL-2, BCL-xL, and Survivin) (12). In our present study, the results suggested that MIRTX exerts anti-tumor effects by inhibiting cell proliferation and invasive capacity, inducing apoptosis, and delaying cell cycle progression. Notably, the antitumor effects of MIRTX were greater than those of miR-29b-3p. Similar to colorectal cancer cells (12), MIRTX treatment of pancreatic cancer cells suppressed the anti-apoptotic proteins MCL-1 and Survivin and induced apoptosis. These results suggest that MIRTX induces cell death by inhibiting anti-apoptosis signaling.

Additionally, MIRTX treatment was associated with changes in cell-cycle-related proteins. A CDK-cyclin complex phosphorylates the Rb protein, and releases it from transcription factor E2F, which induces cell cycle progression from G1 phase to S phase (18). Checkpoint proteins, such as p21WAF1/CIP1 and p27KIP1, also regulate G1-to-S phase transition, inhibiting progression by suppressing the CDK-cyclin complex (19). On the other hand, G2-to-M phase progression is induced by the p-CDC2 complex and cyclin B (20). In pancreatic cancer cells, we showed that MIRTX treatment suppressed the expression of CDK4, CDK6, CDC2, and p-CDC2, and increased p21 expression. RNA sequencing and in silico analysis revealed cyclin A2 and cyclin B2 as potential targets of MIRTX and showed suppression of protein expressions by MIRTX treatment. Taken together, our results suggest that MIRTX delays cell cycle progression in pancreatic cancer cells by perturbating multiple cell-cycle-related and checkpoint-related genes.

Condensin complex proteins were also identified as a potential target of MIRTX. There are two condensin complexes – condensin I, which comprises SMC2, SMC4, NCAPH, NCAPG, and NCAPD2; and condensin II, which comprises SMC2, SMC4, NCAPH2, NCAPG2, and NCAPD3 (21). In silico analysis using TargetScan showed that only NCAPD3 contained the potential binding site of the MIRTX seed sequence; however, we found that MIRTX treatment suppressed all the components in pancreatic cancer cells. The gene expression of condensin complex proteins (except NCAPD3) may be suppressed through an indirect effect. Notably, condensin plays a central role in chromosome condensation and segregation during cell division (22); therefore, the decrease in condensin complex gene expression could be associated with the delayed cell cycle progression after MIRTX treatment. Further investigation of this subject is needed.

Although several miRNA-based therapeutics have been tested in clinical trials, no miRNA-based cancer therapeutics have reached clinical application. One major challenge for miRNA-based therapeutics is the design of miRNA delivery vehicles that can maintain high stability of the therapeutic miRNAs, and precisely transfer them into the tumor tissues, while preventing potential toxicities and off-target effects (23-25).

Given the potent in vitro anti-tumor activity of MIRTX, efficient in vivo delivery will be crucial for future clinical translation. In this context, we have developed super carbonate apatite (sCA), which is a pH-sensitive drug delivery system for miRNA and siRNA, which does not induce significant immune activation (26). We previously demonstrated that sCA nanoparticles successfully delivered various nucleic acids or low-molecular-weight reagents in tumor or inflammatory bowel disease (IBD) model mice, without apparent adverse effects (12, 13, 27-29). Moreover, recent review articles have presented various miRNA-based therapeutics and have described sCA as a hopeful systemic strategy for intravenous delivery (30, 31). It is possible that treatment using MIRTX encapsulated in sCA may be a less toxic and more effective strategy for pancreatic cancer.

Conclusion

We found that MIRTX exerts an anti-tumor effect by suppressing multiple molecules associated with cell cycle progression and apoptosis. These results suggest that MIRTX may be a promising therapeutic miRNA for pancreatic cancer.

Acknowledgements

We thank Sho Ishikawa (Department of Molecular Pathology, Division of Health Sciences, Graduate School of Medicine, Osaka University) for technical assistance.

Footnotes

  • Authors’ Contributions

    Y.Y., A.I., Hirofumi Y., and M.M. designed the study. Y.Y., A.I., and Hirofumi Y. wrote the manuscript. Y.Y., Hiroyuki Y., S.K., Y.I., R.Y., Y.Z., M.T., and N.N. performed the experiments. Y.Y., D.O., and Hirofumi Y. developed the methodology. Y.Y., A.I., Hiroyuki Y., S.K., Y.M., T.H., S.S., and Hirofumi Y. analyzed the data and edited the figures. Y.Y., A.I., Y.M., T.H., S.S., Hirofumi Y., and M.M. read and revised the manuscript. All Authors confirmed and approved all parts of this study.

  • Data Availability Statement

    The raw data were deposited in the NCBI Gene Expression Omnibus database under GEO accession number GSE305460.

  • Conflicts of Interest

    The Authors have no conflicts of interest to declare.

  • Funding

    This work was supported by JSPS KAKENHI Grants Number 15H04920 and 24H00642 (to Hirofumi Yamamoto) and a grant from Kagoshima Shinsangyo Sousei Investment Limited Partnership (its general partner is Kagoshima Development Co., Ltd).

  • Artificial Intelligence (AI) Disclosure

    No artificial intelligence (AI) tools, including large language models or machine learning software, were used in the preparation, analysis, or presentation of this manuscript.

  • Received November 8, 2025.
  • Revision received November 26, 2025.
  • Accepted December 10, 2025.

This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.

References

  1. ↵
    1. Bray F,
    2. Laversanne M,
    3. Sung H,
    4. Ferlay J,
    5. Siegel RL,
    6. Soerjomataram I,
    7. Jemal A
    : Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 74(3): 229-263, 2024. DOI: 10.3322/caac.21834
    OpenUrlCrossRefPubMed
  2. ↵
    1. Barrambana S,
    2. Zamorano-Domínguez E,
    3. Liaki V,
    4. Guerra C
    : Navigating the complexities of pancreatic ductal adenocarcinoma: A review on therapeutic models and RAS inhibitors. Adv Drug Deliv Rev 224: 115652, 2025. DOI: 10.1016/j.addr.2025.115652
    OpenUrlCrossRefPubMed
  3. ↵
    1. Varghese AM,
    2. Perry MA,
    3. Chou JF,
    4. Nandakumar S,
    5. Muldoon D,
    6. Erakky A,
    7. Zucker A,
    8. Fong C,
    9. Mehine M,
    10. Nguyen B,
    11. Basturk O,
    12. Balogun F,
    13. Kelsen DP,
    14. Brannon AR,
    15. Mandelker D,
    16. Vakiani E,
    17. Park W,
    18. Yu KH,
    19. Stadler ZK,
    20. Schattner MA,
    21. Jarnagin WR,
    22. Wei AC,
    23. Chakravarty D,
    24. Capanu M,
    25. Schultz N,
    26. Berger MF,
    27. Iacobuzio-Donahue CA,
    28. Bandlamudi C,
    29. O’Reilly EM
    : Clinicogenomic landscape of pancreatic adenocarcinoma identifies KRAS mutant dosage as prognostic of overall survival. Nat Med 31(2): 466-477, 2025. DOI: 10.1038/s41591-024-03362-3
    OpenUrlCrossRefPubMed
  4. ↵
    1. Corral de la Fuente E,
    2. Olmedo Garcia ME,
    3. Gomez Rueda A,
    4. Lage Y,
    5. Garrido P
    : Targeting KRAS in non-small cell lung cancer. Front Oncol 11: 792635, 2022. DOI: 10.3389/fonc.2021.792635
    OpenUrlCrossRefPubMed
  5. ↵
    1. Norton C,
    2. Shaw MS,
    3. Rubnitz Z,
    4. Smith J,
    5. Soares HP,
    6. Nevala-Plagemann CD,
    7. Garrido-Laguna I,
    8. Florou V
    : KRAS mutation status and treatment outcomes in patients with metastatic pancreatic adenocarcinoma. JAMA Netw Open 8(1): e2453588, 2025. DOI: 10.1001/jamanetworkopen.2024.53588
    OpenUrlCrossRef
  6. ↵
    1. Schwarz DS,
    2. Hutvágner G,
    3. Du T,
    4. Xu Z,
    5. Aronin N,
    6. Zamore PD
    : Asymmetry in the assembly of the RNAi enzyme complex. Cell 115(2): 199-208, 2003. DOI: 10.1016/s0092-8674(03)00759-1
    OpenUrlCrossRefPubMed
  7. ↵
    1. Kim H,
    2. Lee YY,
    3. Kim VN
    : The biogenesis and regulation of animal microRNAs. Nat Rev Mol Cell Biol 26(4): 276-296, 2025. DOI: 10.1038/s41580-024-00805-0
    OpenUrlCrossRef
  8. ↵
    1. He L,
    2. Hannon GJ
    : MicroRNAs: small RNAs with a big role in gene regulation. Nat Rev Genet 5(7): 522-531, 2004. DOI: 10.1038/nrg1379
    OpenUrlCrossRefPubMed
    1. Calin GA,
    2. Croce CM
    : MicroRNA signatures in human cancers. Nat Rev Cancer 6(11): 857-866, 2006. DOI: 10.1038/nrc1997
    OpenUrlCrossRefPubMed
  10. ↵
    1. Diener C,
    2. Keller A,
    3. Meese E
    : The miRNA-target interactions: An underestimated intricacy. Nucleic Acids Res 52(4): 1544-1557, 2024. DOI: 10.1093/nar/gkad1142
    OpenUrlCrossRefPubMed
  11. ↵
    1. Inoue A,
    2. Yamamoto H,
    3. Uemura M,
    4. Nishimura J,
    5. Hata T,
    6. Takemasa I,
    7. Ikenaga M,
    8. Ikeda M,
    9. Murata K,
    10. Mizushima T,
    11. Doki Y,
    12. Mori M
    : MicroRNA-29b is a novel prognostic marker in colorectal cancer. Ann Surg Oncol 22 Suppl 22(S3): 1410-1418, 2015. DOI: 10.1245/s10434-014-4255-8
    OpenUrlCrossRef
  12. ↵
    1. Inoue A,
    2. Mizushima T,
    3. Wu X,
    4. Okuzaki D,
    5. Kambara N,
    6. Ishikawa S,
    7. Wang J,
    8. Qian Y,
    9. Hirose H,
    10. Yokoyama Y,
    11. Ikeshima R,
    12. Hiraki M,
    13. Miyoshi N,
    14. Takahashi H,
    15. Haraguchi N,
    16. Hata T,
    17. Matsuda C,
    18. Doki Y,
    19. Mori M,
    20. Yamamoto H
    : A miR-29b byproduct sequence exhibits potent tumor-suppressive activities via inhibition of NF-κB signaling in KRAS -mutant colon cancer cells. Mol Cancer Ther 17(5): 977-987, 2018. DOI: 10.1158/1535-7163.MCT-17-0850
    OpenUrlAbstract/FREE Full Text
  13. ↵
    1. Fukata T,
    2. Mizushima T,
    3. Nishimura J,
    4. Okuzaki D,
    5. Wu X,
    6. Hirose H,
    7. Yokoyama Y,
    8. Kubota Y,
    9. Nagata K,
    10. Tsujimura N,
    11. Inoue A,
    12. Miyoshi N,
    13. Haraguchi N,
    14. Takahashi H,
    15. Hata T,
    16. Matsuda C,
    17. Kayama H,
    18. Takeda K,
    19. Doki Y,
    20. Mori M,
    21. Yamamoto H
    : The supercarbonate apatite-microRNA complex inhibits dextran sodium sulfate-induced colitis. Mol Ther Nucleic Acids 12: 658-671, 2018. DOI: 10.1016/j.omtn.2018.07.007
    OpenUrlCrossRefPubMed
  14. ↵
    1. Otsu T,
    2. Hayashi M,
    3. Fujita K,
    4. Kobayashi D,
    5. Nakagawa N,
    6. Kurimoto K,
    7. Takami H,
    8. Nakanishi K,
    9. Umeda S,
    10. Shimizu D,
    11. Hattori N,
    12. Kanda M,
    13. Tanaka C,
    14. Nakayama G,
    15. Kodera Y
    : Genome-wide microRNA analysis identified miR-210-3p over-expression in pancreatic cancer tissues as a predictor of their local invasiveness. Anticancer Res 44(11): 4709-4721, 2024. DOI: 10.21873/anticanres.17297
    OpenUrlAbstract/FREE Full Text
    1. Tokuhisa A,
    2. Tsunedomi R,
    3. Kimura Y,
    4. Nakajima M,
    5. Nishiyama M,
    6. Takahashi H,
    7. Ioka T,
    8. Kobayashi S,
    9. Eguchi H,
    10. Nagano H
    : Exosomal miR-141-3p induces gemcitabine resistance in biliary tract cancer cells. Anticancer Res 44(7): 2899-2908, 2024. DOI: 10.21873/anticanres.17102
    OpenUrlAbstract/FREE Full Text
  16. ↵
    1. Saller J,
    2. White D,
    3. Hough B,
    4. Yoder S,
    5. Whiting J,
    6. Chen DT,
    7. Magliocco A,
    8. Coppola D
    : An miRNA signature predicts grading of pancreatic neuroendocrine neoplasms. Cancer Genomics Proteomics 20(2): 154-164, 2023. DOI: 10.21873/cgp.20370
    OpenUrlAbstract/FREE Full Text
  17. ↵
    1. Martino MTD,
    2. Tagliaferri P,
    3. Tassone P
    : MicroRNA in cancer therapy: breakthroughs and challenges in early clinical applications. J Exp Clin Cancer Res 44(1): 126, 2025. DOI: 10.1186/s13046-025-03391-x
    OpenUrlCrossRef
  18. ↵
    1. Pellarin I,
    2. Dall’Acqua A,
    3. Favero A,
    4. Segatto I,
    5. Rossi V,
    6. Crestan N,
    7. Karimbayli J,
    8. Belletti B,
    9. Baldassarre G
    : Cyclin-dependent protein kinases and cell cycle regulation in biology and disease. Signal Transduct Target Ther 10(1): 11, 2025. DOI: 10.1038/s41392-024-02080-z
    OpenUrlCrossRefPubMed
  19. ↵
    1. Abukhdeir AM,
    2. Park BH
    : P21 and p27: roles in carcinogenesis and drug resistance. Expert Rev Mol Med 10: e19, 2008. DOI: 10.1017/S1462399408000744
    OpenUrlCrossRefPubMed
  20. ↵
    1. Stark GR,
    2. Taylor WR
    : Control of the G2/M transition. Mol Biotechnol 32(3): 227-248, 2006. DOI: 10.1385/MB:32:3:227
    OpenUrlCrossRefPubMed
  21. ↵
    1. van Hooff JJE,
    2. Raas MWD,
    3. Tromer EC,
    4. Eme L
    : Repeated duplications and losses shaped SMC complex evolution from archaeal ancestors to modern eukaryotes. Cell Rep 44(7): 115855, 2025. DOI: 10.1016/j.celrep.2025.115855
    OpenUrlCrossRefPubMed
  22. ↵
    1. Hoencamp C,
    2. Rowland BD
    : Genome control by SMC complexes. Nat Rev Mol Cell Biol 24(9): 633-650, 2023. DOI: 10.1038/s41580-023-00609-8
    OpenUrlCrossRefPubMed
  23. ↵
    1. Rupaimoole R,
    2. Slack FJ
    : MicroRNA therapeutics: towards a new era for the management of cancer and other diseases. Nat Rev Drug Discov 16(3): 203-222, 2017. DOI: 10.1038/nrd.2016.246
    OpenUrlCrossRefPubMed
    1. Li Z,
    2. Rana TM
    : Therapeutic targeting of microRNAs: current status and future challenges. Nat Rev Drug Discov 13(8): 622-638, 2014. DOI: 10.1038/nrd4359
    OpenUrlCrossRefPubMed
  25. ↵
    1. Rupaimoole R,
    2. Han HD,
    3. Lopez-Berestein G,
    4. Sood AK
    : MicroRNA therapeutics: principles, expectations, and challenges. Chin J Cancer 30(6): 368-370, 2011. DOI: 10.5732/cjc.011.10186
    OpenUrlCrossRefPubMed
  26. ↵
    1. Wu X,
    2. Yamamoto H,
    3. Nakanishi H,
    4. Yamamoto Y,
    5. Inoue A,
    6. Tei M,
    7. Hirose H,
    8. Uemura M,
    9. Nishimura J,
    10. Hata T,
    11. Takemasa I,
    12. Mizushima T,
    13. Hossain S,
    14. Akaike T,
    15. Matsuura N,
    16. Doki Y,
    17. Mori M
    : Innovative delivery of siRNA to solid tumors by super carbonate apatite. PLoS One 10(3): e0116022, 2015. DOI: 10.1371/journal.pone.0116022
    OpenUrlCrossRefPubMed
  27. ↵
    1. Hiraki M,
    2. Nishimura J,
    3. Takahashi H,
    4. Wu X,
    5. Takahashi Y,
    6. Miyo M,
    7. Nishida N,
    8. Uemura M,
    9. Hata T,
    10. Takemasa I,
    11. Mizushima T,
    12. Soh JW,
    13. Doki Y,
    14. Mori M,
    15. Yamamoto H
    : Concurrent targeting of KRAS and AKT by MiR-4689 is a novel treatment against mutant KRAS colorectal cancer. Mol Ther Nucleic Acids 4(3): e231, 2015. DOI: 10.1038/mtna.2015.5
    OpenUrlCrossRefPubMed
    1. Yamamoto H,
    2. Wu X,
    3. Nakanishi H,
    4. Yamamoto Y,
    5. Uemura M,
    6. Hata T,
    7. Nishimura J,
    8. Takemasa I,
    9. Mizushima T,
    10. Sasaki J,
    11. Imazato S,
    12. Matsuura N,
    13. Doki Y,
    14. Mori M
    : A glucose carbonate apatite complex exhibits in vitro and in vivo anti-tumour effects. Sci Rep 5: 7742, 2015. DOI: 10.1038/srep07742
    OpenUrlCrossRefPubMed
  29. ↵
    1. Tamai K,
    2. Mizushima T,
    3. Wu X,
    4. Inoue A,
    5. Ota M,
    6. Yokoyama Y,
    7. Miyoshi N,
    8. Haraguchi N,
    9. Takahashi H,
    10. Nishimura J,
    11. Hata T,
    12. Matsuda C,
    13. Doki Y,
    14. Mori M,
    15. Yamamoto H
    : Photodynamic therapy using indocyanine green loaded on super carbonate apatite as minimally invasive cancer treatment. Mol Cancer Ther 17(7): 1613-1622, 2018. DOI: 10.1158/1535-7163.MCT-17-0788
    OpenUrlAbstract/FREE Full Text
  30. ↵
    1. Takahashi RU,
    2. Prieto-Vila M,
    3. Kohama I,
    4. Ochiya T
    : Development of miRNA-based therapeutic approaches for cancer patients. Cancer Sci 110(4): 1140-1147, 2019. DOI: 10.1111/cas.13965
    OpenUrlCrossRefPubMed
  31. ↵
    1. Merhautova J,
    2. Demlova R,
    3. Slaby O
    : MicroRNA-based therapy in animal models of selected gastrointestinal cancers. Front Pharmacol 7: 329, 2016. DOI: 10.3389/fphar.2016.00329
    OpenUrlCrossRefPubMed
Back to top

In this issue

Print
Download PDF
Article Alerts
Email Article
Citation Tools
Reprints and Permissions
The miR-29b Byproduct MIRTX Shows Superior Anti-tumor Activity, Compared to miR-29b-3p, in Pancreatic Cancer Cells
YUHKI YOKOYAMA, AKIRA INOUE, HIROYUKI YAMAMOTO, SHIHORI KOUDA, YUMA IRIE, RUIJIA YANG, YINGJUE ZHANG, MANAMI TSUJIMOTO, NANAMI NAGATA, YOSHIHIRO MORIMOTO, TSUYOSHI HATA, DAISUKE OKUZAKI, SATOSHI SHIBATA, HIROFUMI YAMAMOTO, MASAKI MORI
Anticancer Research Feb 2026, 46 (2) 619-632; DOI: 10.21873/anticanres.17974
Twitter logo Facebook logo Mendeley logo

Jump to section

Keywords