Research ArticleExperimental Studies
Open Access

Activation of DCTN1-RET Fusion Through Coiled-coil Domain as a Potential Target for RET Inhibitors

KOHEI HAYASHI, KEIJI ISHIDA, MASANORI KATO, SHUICHI OHKUBO and YOSHIHIRO UTO
Anticancer Research April 2025, 45 (4) 1407-1417; DOI: https://doi.org/10.21873/anticanres.17526

Abstract

Background/Aim: The REarranged during Transfection (RET) proto-oncogene fusion is a typical cancer driver gene frequently observed in thyroid and lung cancers. This study characterized the novel dynactin subunit 1 (DCTN1)-RET fusion gene and evaluated the efficacy of RET inhibitors against this fusion.

Materials and Methods: Thyroid cancer tissue DNA samples were sequenced to identify fusion genes, and an expression vector was generated using extracted RNA. Cell lines stably expressing DCTN1-RET variants, including those lacking the coiled-coil (CC) domain, were established. The functionality of these variants and therapeutic efficacy of RET inhibitors were examined both in vitro and in vivo.

Results: The DCTN1-RET fusion gene contains the CC domain from DCTN1 and the kinase domain from RET. Deletion of the CC domain abrogated dimer formation and reduced RET and extracellular signal-regulated kinase phosphorylation. Cells expressing DCTN1-RET exhibited enhanced proliferation and tumorigenesis in vivo. The RET inhibitor TAS0286 effectively suppressed DCTN1-RET-mediated RET autophosphorylation and tumor growth in a mouse subcutaneous tumor model.

Conclusion: DCTN1-RET is a novel oncogenic fusion gene in thyroid cancer that promotes tumorigenesis through CC domain-mediated dimerization. It represents a potential therapeutic target for RET-specific inhibitors.

Keywords:

Introduction

The REarranged during Transfection (RET) proto-oncogene encodes a single-pass transmembrane receptor tyrosine kinase that plays a crucial role in kidney development and neural cell function (1, 2). Aberrant RET signaling is implicated in various malignancies, such as medullary thyroid carcinoma, non-small cell lung cancer (NSCLC), and others. RET alterations, including chromosomal rearrangements (fusions), point mutations, copy number gains, and over-expression, lead to constitutive activation of the RET signaling pathway (3, 4).

RET fusion is detected in 5-10% of adult papillary thyroid carcinomas (PTC) and 1–2% of NSCLC cases (5, 6). Common fusion partners include coiled-coil domain containing 6 (CCDC6), kinesin family member 5B (KIF5B), and nuclear receptor coactivator 4 (NCOA4), whose coiled-coil (CC) domains facilitate dimerization (7-9) and activation of downstream signaling cascades, such as the mitogen-activated protein kinase (MAPK) and phosphoinositide 3-kinase (PI3K) pathways (8, 10). These pathways regulate critical cellular processes, including cell proliferation, migration, and differentiation, underscoring the critical role of CC domains in RET fusion-mediated tumorigenesis.

Clinically, RET-selective inhibitors, such as selpercatinib and pralsetinib, have shown efficacy in treating cancers harboring RET fusions, validating the therapeutic potential of targeting RET signaling (11, 12).

Dynactin subunit 1 (DCTN1), a key component of the dynactin complex, has roles in intracellular cargo transportation (13, 14) and is implicated in neurodegenerative disorders, such as amyotrophic lateral sclerosis (ALS) and Perry syndrome (15, 16). Additionally, DCTN1 is a fusion partner for anaplastic lymphoma kinase (ALK) in certain cancer types (17-20). ALK fusion is an established oncogenic driver, particularly in NSCLC. The CC domain reportedly contributes to homeostatic activation of the fusion gene, and the ALK inhibitor crizotinib has shown both preclinical and clinical efficacies against DCTN1-ALK (21-23).

Although next-generation sequencing (NGS) has made marked progress, the activation mechanisms of many fusion genes remains unknown. Here, we identified DCTN1-RET as a novel RET fusion gene in thyroid cancer and evaluated its functional properties and therapeutic potential. We further assessed the RET-selective inhibitor TAS0286 (24) for its ability to inhibit DCTN1-RET-mediated oncogenic activity both in vitro and in vivo.

Materials and Methods

Clinical samples and cell lines. Thyroid cancer tissue samples were purchased from ASTERAND (Detroit, MI, USA). TAS0286 and cabozantinib were synthesized by Taiho Pharmaceutical (Ibaraki, Japan). Compounds were dissolved in dimethyl sulfoxide (DMSO) for in vitro experiments. Jump-In GripTite HEK293 cells were obtained from Thermo Fisher Scientific (Waltham, MA, USA) and cultured high-glucose Dulbecco’s modified Eagle’s medium (DMEM) containing GlutaMAX and pyruvate (Thermo Fisher Scientific) and supplemented with 25 mM 4-(2-hydroxyethyl)-1-piperazine-ethanesulfonic acid (Thermo Fisher Scientific), 0.1 mM minimum essential medium non-essential amino acids (Thermo Fisher Scientific), 100 U/ml penicillin, 100 μg/ml streptomycin (Thermo Fisher Scientific), and 10% dialyzed fetal bovine serum (FBS) (PEAK SERUM, Wellington, CO, USA). NIH/3T3 cell line was purchased from ATCC (Manassas, VA, USA) and cultured in DMEM supplemented with 10% newborn bovine calf serum. To engineer NIH/3T3-expressing DCTN1-RET, cDNA constructs of DCTN1-RET were transfected into NIH/3T3 cells using ViaFect (Promega, Madison, WI, USA), followed by clone selection using hygromycin.

Sequence analysis. NGS analysis (FusionPlex Panel) and Sanger sequencing were performed by Riken Genesis (Tokyo, Japan). RNA was extracted from clinical samples and used for first-strand cDNA synthesis with the SuperScript VILO (Thermo Fisher Scientific). Nested PCR was performed with the following primers:

First PCR: TGTCCAGCTTTGTGCCTGATTGATGT and GCTGGGCACTGAAGAGAAAGGAATGC.

Second PCR: AGCAGGATGAGTGCGGAGGCAAGC and TTAACTATCAAACGTGTCCATTAATTTTGCCGC.

PCR fragments were purified using agarose gel electrophoresis and cloned into pUC18 vectors for sequencing. Sanger sequencing was performed by Takara Bio (Shiga, Japan).

Fluorescence in situ hybridization (FISH). FISH for DCTN1-RET was performed by GeneticLab (Hokkaido, Japan).

Expression vectors and transfection. The expression vectors for DCTN1-RET and deletion constructs were generated using pcDNA3.1-Hyg by TechnoPro (Tokyo, Japan). Jump-In GripTite HEK293 cells were seeded in 6-well plates under antibiotics-free conditions. Plasmids were transfected using Lipofectamine 3000 (Thermo Fisher Scientific) 24 h post-seeding. Forty-eight hours later, the medium was switched to serum-free medium, and cells were collected 24 h later.

Immunoblot assay. Cells were lysed in radioimmuno-precipitation buffer (Thermo Fisher Scientific) supplemented with phosphatase and protease inhibitors (Thermo Fisher Scientific). The supernatants were collected following centrifugation, and protein concentrations were quantified using the Pierce bicinchoninic acid protein assay kit (Thermo Fisher Scientific).

Proteins were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (PAGE) or native PAGE, transferred to polyvinylidene fluoride membranes, and blocked using Blocking One-P (Nacalai Tesque, Kyoto, Japan). Primary antibodies were incubated overnight in a cold room. After washing, membranes were incubated with horseradish peroxidase-linked immunoglobulin G secondary antibodies (GE Healthcare, Chicago, IL, USA). Signals were detected using Chemi-Lumi One (Nacalai Tesque) on an Amersham Imager 600 QC (Cytiva, Marlborough, MA, USA). Primary antibodies were obtained from Cell Signaling Technologies (Danvers, MA, USA) (Ret #3223, Phospho-Ret #3221, AKT #4685, Phospho-AKT #4060, ERK #4695, Phospho-ERK #4370, GAPDH #5174), Abcam (Cambridge, UK) (RET #ab134100), Thermo Fisher Scientific (DCTN1 #MA5-18308), and Sigma-Aldrich (St. Louis, MO, USA) (FLAG #A3854). Secondary antibodies were obtained from GE Healthcare (Rabbit IgG HRP NA9340, Mouse IgG HRP #NA9310).

Cell proliferation assay. NIH/3T3 cells expressing DCTN1-RET were seeded in 96-well plates (1,000 cells per well) and treated with TAS0286 or cabozantinib for 72 h. Cell viability was assessed by measuring luminescence using the CellTiter-Glo 2.0 Assay (Promega). Growth inhibition 50% (GI50) values were calculated using the SAS software package in EXSUS.

Animal studies. All animal experiments were approved by the Institutional Animal Care and Use Committee of Taiho Pharmaceutical (Ibaraki, Japan). NIH/3T3 cells expressing DCTN1-RET (NIH/3T3_DCTN1-RET, 5×106 cells) were inoculated subcutaneously into the flanks of 6-week-old female athymic nude mice. Tumor-bearing mice were randomized based on tumor size and treated daily with oral doses of TAS0286 or cabozantinib. Cabozantinib was formulated in 0.5 w/v% hydroxypropyl methylcellulose (HPMC). TAS0286 was prepared in 0.5 w/v% HPMC and 0.1 mol/l Hydrochloric Acid. Tumor volume and body weight were measured twice weekly. Statistical analysis of tumor volume was conducted using the Dunnett’s test with JMP version 17.

Results

DCTN1-RET fusion gene detected in thyroid cancer tissue. Our investigation focused on identifying fusion genes in thyroid cancer due to their high incidence, particularly RET and ALK fusions. We utilized the Archer FusionPlex Panel to detect fusion genes regardless of the partner. Among 16 thyroid cancer samples, two fusion genes were detected: STRN-ALK, a known oncogenic driver (25) and the novel DCTN1-RET fusion (Figure 1A). To validate the presence of DCTN1-RET fusion, we performed FISH on thyroid tissue samples, confirming its occurrence (Figure 1B). Additionally, the DCTN1-RET transcript was further verified through reverse transcription PCR, generating full-length complementary DNA from clinical samples. The full-length DCTN1-RET fusion sequence was confirmed using Sanger sequencing, revealing that it retains a CC domain from DCTN1 and a kinase domain from RET (Figure 1C).

Figure 1.
Figure 1.
Figure 1.

Detection of the DCTN1-RET fusion gene in thyroid cancer tissue. (A) DCTN1-RET reads by Archer FusionPlex Panel were mapped to DCTN1 and RET reference sequences. (B) Break-apart FISH was conducted on thyroid tissue samples using probes targeting the N terminal of DCTN1 (green signals) and C terminal of RET (red signals). Co-localized signals indicate the presence of the DCTN1-RET fusion, while no RET fusion genes were detected in NGS-negative samples. (C) Schematic representation of the DCTN1-RET fusion protein, showing the fusion of the N-terminal coiled-coil (CC) domain of DCTN1 with the intracellular tyrosine kinase domain of RET.

DCTN1-RET exhibits tumorigenic properties. We first examined the structural characteristics of DCTN1-RET, noting that two major CC domains of DCTN1 facilitate self-dimerization (26, 27). To assess their role in DCTN1-RET, we developed four types of DCTN1-RET expression vectors, each tagged with FLAG (Figure 2A). These vectors included full-length DCTN1-RET and variants lacking one or both CC domains of DCTN1. Transfection of these vectors into Jump-In GripTite HEK293 cells allowed for the expression of the variant fusion genes. Native PAGE analysis with an anti-FLAG antibody revealed a band corresponding to the full-length DCTN1-RET, which we interpreted as a dimer. Variants ΔCC1 and ΔCC2 displayed bands at positions similar to those of the full-length protein, while the ΔCC1-2 variant lacked the corresponding band (Figure 2B). This is similar to the results of previous studies on tropomyosin 3 (TPM3)-ALK and STRN-ALK, where deletion of the CC domain diminished dimerization (25, 28).

Figure 2.
Figure 2.
Figure 2.

Tumorigenic properties of the DCTN1-RET fusion protein. (A) Schematic representation of DCTN1-RET fusion gene expression vectors, including the full-length construct with a FLAG tag and deletion constructs lacking specific CC regions of DCTN1. Predicted molecular weights: 177 kDa (full-length), 138 kDa (ΔCC1), 163 kDa (ΔCC2), and 82 kDa (ΔCC1-2). (B) Native-PAGE analysis revealed the dimeric and monomeric forms of DCTN1-RET in Jump-In GripTite HEK293 cells transfected with the respective constructs. (C) Western blot analysis of protein expression in Jump-In GripTite HEK293 cells transfected with each DCTN1-RET construct. Expression levels of RET, phosphorylated RET (pRET), AKT, phosphorylated AKT (pAKT), ERK, phosphorylated ERK (pERK), DCTN1, and FLAG were evaluated. (D) Cell proliferation was assessed in parental NIH/3T3 and NIH/3T3_DCTN1-RET cells on days 1 and 8. Representative images of colony formation are shown for both cell types on day 8, demonstrating enhanced growth in NIH/3T3_DCTN1-RET cells. (E) Western blot analysis confirmed RET, pRET, and DCTN1 expression in the stably expressing NIH/3T3_DCTN1-RET cell line. (F) Tumorigenic potential was evaluated in mice inoculated with NIH/3T3_DCTN1-RET cells (n=12). The image shows a representative mouse on day 17 post-inoculation. Tumor growth kinetics are plotted, demonstrating progressive tumor formation in the NIH/3T3_DCTN1-RET allograft model.

Because deletion of the CC domain also diminished activated ALK signaling in TPM3-ALK and STRN-ALK, our findings indicated that DCTN1-RET dimer formation may also affect RET signaling pathways. We assessed phosphorylation levels of RET and downstream targets, including extracellular signal-regulated kinase (ERK) and protein kinase B (AKT), through western blot analysis. Although RET expression level varied among the three variants (full-length, ΔCC1, and ΔCC2), RET, ERK, and AKT phosphorylation levels were comparable. Notably, the ΔCC1-2 variant, which does not form dimers, induced moderate RET and ERK phosphorylation compared with the other variants (Figure 2C).

To further explore the tumorigenic potential of DCTN1-RET, we established NIH/3T3 cell lines expressing the DCTN1-RET fusion gene (NIH/3T3_DCTN1-RET). A colony formation assay showed that NIH/3T3_DCTN1-RET cells exhibited significantly enhanced proliferation compared to that of parental cells (Figure 2D). Increased expression of phosphorylated RET in NIH/3T3_DCTN1-RET cells was also confirmed using western blotting (Figure 2E). Additionally, we inoculated NIH/3T3_DCTN1-RET cells into mice to assess tumor formation in subcutaneous tissue. Tumor formation and time-dependent tumor growth were observed in all tested mice (12/12) (Figure 2F).

These findings confirm that DCTN1-RET functions as an oncogenic driver, with CC domain-mediated dimerization playing a critical role in activating RET signaling pathways and driving tumorigenesis.

DCTN1-RET as a therapeutic target using the RET inhibitor TAS0286. We investigated the effect of the RET-selective inhibitor TAS0286 on cell proliferation and signaling in NIH/3T3_DCTN1-RET cells. The in vitro cell proliferation of NIH/3T3_DCTN1-RET was inhibited by TAS0286. The inhibitory effect, particularly as measured by GI50, was 10 times stronger than that of cabozantinib, a multi-kinase inhibitor with weaker anti-RET activity (Figure 3A). TAS0286 treatment also resulted in dose-dependent reduction in RET phosphorylation (Figure 3B).

Figure 3.
Figure 3.

Therapeutic potential of the RET selective inhibitor TAS0286 for targeting DCTN1-RET fusion. (A) Cell viability was assessed using the CellTiter-Glo assay in NIH/3T3_DCTN1-RET cells treated with TAS0286 or cabozantinib for 72 h, and the GI50 values for both compounds were calculated. (B) Western blot analysis of RET and pRET expression in NIH/3T3_DCTN1-RET cells treated with TAS0286 for 1 h. GAPDH served as a loading control. (C) Tumor volume measurement over 14 days in an NIH3/T3_DCTN1-RET allograft mouse model treated with TAS0286 (50 mg/kg/day, b.i.d, p.o.) or cabozantinib (30 mg/kg/day, q.d., p.o.). Data are shown as mean±S.E. (n=5 per group). The volume of tumors in treatment groups was significantly lower than that of vehicle-treated groups (p<0.001).

To evaluate the therapeutic efficacy of these inhibitors, we utilized a mouse allograft model in which NIH/3T3_DCTN1-RET cells were inoculated subcutaneously. Treatment with TAS0286 (50 mg/kg, twice daily) significantly inhibited tumor growth compared to that of the vehicle control group (n=5, p<0.001) (Figure 3C).

These findings suggest that RET inhibitors effectively suppress the oncogenic activity of DCTN1-RET.

Discussion

Using the Archer FusionPlex NGS panel, which enables detection of fusion genes, even without prior knowledge of the partner gene, we analyzed thyroid cancer tissue samples. While commonly observed RET fusions, such as CCDC6-RET and NCOA4-RET, were absent in our cohort, we identified the DCTN1-RET fusion in one out of 16 samples, corresponding to a prevalence of 6.3%. However, given the rarity of previous reports, the actual prevalence of DCTN1-RET is likely lower.

Major RET fusions are characterized by retention of essential kinase and CC domains, which are crucial for dimerization, tumorigenesis, and cancer progression, as exemplified by CCDC6-RET and KIF5B-RET (29, 30). Our sequencing analysis revealed that DCTN1-RET similarly retains those domains. Dynactin, encoded by DCTN1, forms a complex with dynein that is crucial for intracellular transport and includes a microtubule-binding domain and two CC domains (13, 31, 32). These findings strongly suggest that DCTN1-RET utilizes the CC domain of DCTN1 to facilitate dimerization and activate oncogenic signaling pathways.

Previous studies on TPM3-ALK have highlighted the essential role of CC domains in oncogenic activity, such as promoting dimerization, autophosphorylation, and downstream signaling (28). To investigate the role of the CC domains in DCTN1-RET, we generated deletion constructs lacking CC1, CC2, or both (ΔCC1-2). While full-length DCTN1-RET and constructs lacking either CC1 or CC2 independently formed dimers, the ΔCC1-2 construct, which lacks both CC domains, failed to dimerize. Reduced phosphorylated ERK levels in the ΔCC1-2 construct further suggest that RET kinase activity depends on CC domain-mediated dimerization, independent of ligand binding. Interestingly, RET autophosphorylation and AKT phosphorylation were not significantly reduced in the ΔCC1-2 construct. This observation might be explained by the use of a strong cytomegalovirus promoter driving RET over-expression, which could activate certain signaling pathways independent of dimerization. Further investigation under physiological expression levels is warranted.

Another notable feature of DCTN1-RET is absence of the extracellular domain of RET, which is typically recognized by ubiquitin ligases for degradation (33, 34). Its replacement with DCTN1 likely prevents ubiquitin-mediated degradation, potentially leading to increased RET stability, over-expression, and phosphorylation.

To confirm the oncogenic potential of DCTN1-RET, we established NIH/3T3_DCTN1-RET cells. These cells exhibited significantly enhanced colony formation compared to parental NIH/3T3 cells and formed subcutaneous tumors in mice, demonstrating their tumorigenic capacity. These findings align with studies on other oncogenic fusion genes, such as RET and ALK, which similarly promote enhanced proliferation and tumor formation.

Given the dependence of DCTN1-RET on RET kinase activation, selective RET inhibitors represent a promising therapeutic strategy. Drugs like selpercatinib and pralsetinib have shown clinical efficacy in patients with RET fusion genes and are approved for treating RET-altered cancers (11, 12). Here, we evaluated the efficacy of TAS0286, a highly selective and potent RET kinase inhibitor. TAS0286 significantly inhibited cell proliferation and RET phosphorylation in DCTN1-RET cells and demonstrated superior efficacy to cabozantinib in both in vitro and in vivo models. Moreover, TAS0286 effectively suppressed tumor growth in a mouse allograft model, providing strong evidence that DCTN1-RET is a RET signaling-dependent oncogenic driver.

Conclusion

The DCTN1-RET fusion gene represents a novel RET-dependent oncogenic driver in thyroid cancer. Our findings establish its oncogenic potential and underscore the therapeutic promise of selective RET inhibitors, such as TAS-286, for targeting this fusion. Future studies are needed to assess its prevalence in larger cohorts and to further explore the clinical efficacy of RET inhibitors in patients harboring DCTN1-RET.

Acknowledgements

The Authors thank all the departments at the Discovery and Preclinical Research Division of Taiho Pharmaceutical Co., Ltd. for the support they provided for this work.

Footnotes

  • Authors’ Contributions

    Kohei Hayashi: Investigation and writing – original draft. Keiji Ishida: Investigation. Masanori Kato: Review and editing. Shuichi Ohkubo: Supervision, Yoshihiro Uto: Supervision.

  • Conflicts of Interest

    The Authors declare no conflicts of interest in relation to this study.

  • Funding

    This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

  • Received February 20, 2025.
  • Revision received March 6, 2025.
  • Accepted March 7, 2025.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY-NC-ND) 4.0 international license (https://creativecommons.org/licenses/by-nc-nd/4.0).

References

  1. ↵
    1. Chi X,
    2. Michos O,
    3. Shakya R,
    4. Riccio P,
    5. Enomoto H,
    6. Licht JD,
    7. Asai N,
    8. Takahashi M,
    9. Ohgami N,
    10. Kato M,
    11. Mendelsohn C,
    12. Costantini F
    : Ret-dependent cell rearrangements in the Wolffian duct epithelium initiate ureteric bud morphogenesis. Dev Cell 17(2): 199-209, 2009. DOI: 10.1016/j.devcel.2009.07.013
    OpenUrlCrossRefPubMed
  2. ↵
    1. Ivanchuk SM,
    2. Eng C,
    3. Cavenee WK,
    4. Mulligan LM
    : The expression of RET and its multiple splice forms in developing human kidney. Oncogene 14(15): 1811-1818, 1997. DOI: 10.1038/sj.onc.1201016
    OpenUrlCrossRefPubMed
  3. ↵
    1. Novello S,
    2. Califano R,
    3. Reinmuth N,
    4. Tamma A,
    5. Puri T
    : RET fusion-positive non-small cell lung cancer: the evolving treatment landscape. Oncologist 28(5): 402-413, 2023. DOI: 10.1093/oncolo/oyac264
    OpenUrlCrossRefPubMed
  4. ↵
    1. Salvatore D,
    2. Santoro M,
    3. Schlumberger M
    : The importance of the RET gene in thyroid cancer and therapeutic implications. Nat Rev Endocrinol 17(5): 296-306, 2021. DOI: 10.1038/s41574-021-00470-9
    OpenUrlCrossRefPubMed
  5. ↵
    1. Drilon A,
    2. Hu ZI,
    3. Lai GGY,
    4. Tan DSW
    : Targeting RET-driven cancers: lessons from evolving preclinical and clinical landscapes. Nat Rev Clin Oncol 15(3): 151-167, 2018. DOI: 10.1038/nrclinonc.2017.175
    OpenUrlCrossRefPubMed
  6. ↵
    1. Zhou L,
    2. Li J,
    3. Zhang X,
    4. Xu Z,
    5. Yan Y,
    6. Hu K
    : An integrative pan cancer analysis of RET aberrations and their potential clinical implications. Sci Rep 12(1): 13913, 2022. DOI: 10.1038/s41598-022-17791-y
    OpenUrlCrossRefPubMed
  7. ↵
    1. Ferrara R,
    2. Auger N,
    3. Auclin E,
    4. Besse B
    : Clinical and translational implications of RET rearrangements in non–small cell lung cancer. J Thorac Oncol 13(1): 27-45, 2018. DOI: 10.1016/j.jtho.2017.10.021
    OpenUrlCrossRefPubMed
  8. ↵
    1. Subbiah V,
    2. Yang D,
    3. Velcheti V,
    4. Drilon A,
    5. Meric-Bernstam F
    : State-of-the-art strategies for targeting RET-dependent cancers. J Clin Oncol 38(11): 1209-1221, 2020. DOI: 10.1200/JCO.19.02551
    OpenUrlCrossRefPubMed
  9. ↵
    1. Takahashi M,
    2. Kawai K,
    3. Asai N
    : Roles of the RET proto-oncogene in cancer and development. JMA J 3(3): 175-181, 2020. DOI: 10.31662/jmaj.2020-0021
    OpenUrlCrossRefPubMed
  10. ↵
    1. Qiu T,
    2. Kong Y,
    3. Wei G,
    4. Sun K,
    5. Wang R,
    6. Wang Y,
    7. Chen Y,
    8. Wang W,
    9. Zhang Y,
    10. Jiang C,
    11. Yang P,
    12. Xie T,
    13. Chen X
    : CCDC6-RET fusion protein regulates Ras/MAPK signaling through the fusion-GRB2-SHC1 signal niche. Proc Natl Acad Sci U.S.A. 121(23): e2322359121, 2024. DOI: 10.1073/pnas.2322359121
    OpenUrlCrossRefPubMed
  11. ↵
    1. Drilon A,
    2. Oxnard GR,
    3. Tan DSW,
    4. Loong HHF,
    5. Johnson M,
    6. Gainor J,
    7. McCoach CE,
    8. Gautschi O,
    9. Besse B,
    10. Cho BC,
    11. Peled N,
    12. Weiss J,
    13. Kim YJ,
    14. Ohe Y,
    15. Nishio M,
    16. Park K,
    17. Patel J,
    18. Seto T,
    19. Sakamoto T,
    20. Rosen E,
    21. Shah MH,
    22. Barlesi F,
    23. Cassier PA,
    24. Bazhenova L,
    25. De Braud F,
    26. Garralda E,
    27. Velcheti V,
    28. Satouchi M,
    29. Ohashi K,
    30. Pennell NA,
    31. Reckamp KL,
    32. Dy GK,
    33. Wolf J,
    34. Solomon B,
    35. Falchook G,
    36. Ebata K,
    37. Nguyen M,
    38. Nair B,
    39. Zhu EY,
    40. Yang L,
    41. Huang X,
    42. Olek E,
    43. Rothenberg SM,
    44. Goto K,
    45. Subbiah V
    : Efficacy of selpercatinib in RET fusion-positive non-small-cell lung cancer. N Engl J Med 383(9): 813-824, 2020. DOI: 10.1056/NEJMoa2005653
    OpenUrlCrossRefPubMed
  12. ↵
    1. Gainor JF,
    2. Curigliano G,
    3. Kim DW,
    4. Lee DH,
    5. Besse B,
    6. Baik CS,
    7. Doebele RC,
    8. Cassier PA,
    9. Lopes G,
    10. Tan DSW,
    11. Garralda E,
    12. Paz-Ares LG,
    13. Cho BC,
    14. Gadgeel SM,
    15. Thomas M,
    16. Liu SV,
    17. Taylor MH,
    18. Mansfield AS,
    19. Zhu VW,
    20. Clifford C,
    21. Zhang H,
    22. Palmer M,
    23. Green J,
    24. Turner CD,
    25. Subbiah V
    : Pralsetinib for RET fusion-positive non-small-cell lung cancer (ARROW): a multi-cohort, open-label, phase 1/2 study. Lancet Oncol 22(7): 959-969, 2021. DOI: 10.1016/s1470-2045(21)00247-3
    OpenUrlCrossRefPubMed
  13. ↵
    1. Chaaban S,
    2. Carter AP
    : Structure of dynein-dynactin on microtubules shows tandem adaptor binding. Nature 610(7930): 212-216, 2022. DOI: 10.1038/s41586-022-05186-y
    OpenUrlCrossRef
  14. ↵
    1. Kwinter DM,
    2. Lo K,
    3. Mafi P,
    4. Silverman MA
    : Dynactin regulates bidirectional transport of dense-core vesicles in the axon and dendrites of cultured hippocampal neurons. Neuroscience 162(4): 1001-1010, 2009. DOI: 10.1016/j.neuroscience.2009.05.038
    OpenUrlCrossRefPubMed
  15. ↵
    1. Farrer MJ,
    2. Hulihan MM,
    3. Kachergus JM,
    4. Dächsel JC,
    5. Stoessl AJ,
    6. Grantier LL,
    7. Calne S,
    8. Calne DB,
    9. Lechevalier B,
    10. Chapon F,
    11. Tsuboi Y,
    12. Yamada T,
    13. Gutmann L,
    14. Elibol B,
    15. Bhatia KP,
    16. Wider C,
    17. Vilariño-Güell C,
    18. Ross OA,
    19. Brown LA,
    20. Castanedes-Casey M,
    21. Dickson DW,
    22. Wszolek ZK
    : DCTN1 mutations in Perry syndrome. Nat Genet 41(2): 163-165, 2009. DOI: 10.1038/ng.293
    OpenUrlCrossRefPubMed
  16. ↵
    1. Ueda T,
    2. Takeuchi T,
    3. Fujikake N,
    4. Suzuki M,
    5. Minakawa EN,
    6. Ueyama M,
    7. Fujino Y,
    8. Kimura N,
    9. Nagano S,
    10. Yokoseki A,
    11. Onodera O,
    12. Mochizuki H,
    13. Mizuno T,
    14. Wada K,
    15. Nagai Y
    : Dysregulation of stress granule dynamics by DCTN1 deficiency exacerbates TDP-43 pathology in Drosophila models of ALS/FTD. Acta Neuropathol Commun 12(1): 20, 2024. DOI: 10.1186/s40478-024-01729-8
    OpenUrlCrossRefPubMed
  17. ↵
    1. Dickson BC,
    2. Swanson D,
    3. Charames GS,
    4. Fletcher CD,
    5. Hornick JL
    : Epithelioid fibrous histiocytoma: molecular characterization of ALK fusion partners in 23 cases. Mod Pathol 31(5): 753-762, 2018. DOI: 10.1038/modpathol.2017.191
    OpenUrlCrossRefPubMed
    1. Fung CK,
    2. Chow C,
    3. Chan WK,
    4. Choi EWK,
    5. To KF,
    6. Chan JKC,
    7. Cheuk W
    : Spindle cell/sclerosing rhabdomyosarcoma with DCTN1::ALK fusion: broadening the molecular spectrum with potential therapeutic implications. Virchows Arch 480(4): 927-932, 2022. DOI: 10.1007/s00428-022-03305-8
    OpenUrlCrossRefPubMed
    1. Subbiah V,
    2. McMahon C,
    3. Patel S,
    4. Zinner R,
    5. Silva EG,
    6. Elvin JA,
    7. Subbiah IM,
    8. Ohaji C,
    9. Ganeshan DM,
    10. Anand D,
    11. Levenback CF,
    12. Berry J,
    13. Brennan T,
    14. Chmielecki J,
    15. Chalmers ZR,
    16. Mayfield J,
    17. Miller VA,
    18. Stephens PJ,
    19. Ross JS,
    20. Ali SM
    : STUMP un”stumped”: anti-tumor response to anaplastic lymphoma kinase (ALK) inhibitor based targeted therapy in uterine inflammatory myofibroblastic tumor with myxoid features harboring DCTN1-ALK fusion. J Hematol Oncol 8: 66, 2015. DOI: 10.1186/s13045-015-0160-2
    OpenUrlCrossRefPubMed
  20. ↵
    1. Vendrell JA,
    2. Taviaux S,
    3. Béganton B,
    4. Godreuil S,
    5. Audran P,
    6. Grand D,
    7. Clermont E,
    8. Serre I,
    9. Szablewski V,
    10. Coopman P,
    11. Mazières J,
    12. Costes V,
    13. Pujol JL,
    14. Brousset P,
    15. Rouquette I,
    16. Solassol J
    : Detection of known and novel ALK fusion transcripts in lung cancer patients using next-generation sequencing approaches. Sci Rep 7(1): 12510, 2017. DOI: 10.1038/s41598-017-12679-8
    OpenUrlCrossRefPubMed
  21. ↵
    1. Gao F,
    2. Gao F,
    3. Wu H,
    4. Lu J,
    5. Xu Y,
    6. Zhao Y
    : Response to ALK-TKIs in a lung adenocarcinoma patient harboring dual DCTN1-ALK and ALK-CLIP4 rearrangements. Thorac Cancer 13(7): 1088-1090, 2022. DOI: 10.1111/1759-7714.14345
    OpenUrlCrossRefPubMed
    1. Michels SYF,
    2. Scheel AH,
    3. Wündisch T,
    4. Heuckmann JM,
    5. Menon R,
    6. Puesken M,
    7. Kobe C,
    8. Pasternack H,
    9. Heydt C,
    10. Scheffler M,
    11. Fischer R,
    12. Schultheis AM,
    13. Merkelbach-Bruse S,
    14. Heukamp L,
    15. Büttner R,
    16. Wolf J
    : ALK(G1269A) mutation as a potential mechanism of acquired resistance to crizotinib in an ALK-rearranged inflammatory myofibroblastic tumor. NPJ Precis Oncol 1(1): 4, 2017. DOI: 10.1038/s41698-017-0004-3
    OpenUrlCrossRefPubMed
  23. ↵
    1. Shimada Y,
    2. Kohno T,
    3. Ueno H,
    4. Ino Y,
    5. Hayashi H,
    6. Nakaoku T,
    7. Sakamoto Y,
    8. Kondo S,
    9. Morizane C,
    10. Shimada K,
    11. Okusaka T,
    12. Hiraoka N
    : An oncogenic ALK fusion and an RRAS mutation in KRAS mutation-negative pancreatic ductal adenocarcinoma. Oncologist 22(2): 158-164, 2017. DOI: 10.1634/theoncologist.2016-0194
    OpenUrlAbstract/FREE Full Text
  24. ↵
    1. Fujita H,
    2. Miyazaki I,
    3. Kato M,
    4. Yamada Y,
    5. Ishida K,
    6. Haruma T,
    7. Nagasaki H,
    8. Ito K,
    9. Hashimoto A,
    10. Kodama Y,
    11. Funabashi K,
    12. Lovati E,
    13. Miyadera K,
    14. Matsuo K,
    15. Iwasawa Y
    : TAS0286/HM05, a novel highly selective RET inhibitor, prominently inhibits various RET defective tumor growth. Cancer Res 78 (13_Supplement): 4784, 2018. DOI: 10.1158/1538-7445.AM2018-4784
    OpenUrlCrossRef
  25. ↵
    1. Kelly LM,
    2. Barila G,
    3. Liu P,
    4. Evdokimova VN,
    5. Trivedi S,
    6. Panebianco F,
    7. Gandhi M,
    8. Carty SE,
    9. Hodak SP,
    10. Luo J,
    11. Dacic S,
    12. Yu YP,
    13. Nikiforova MN,
    14. Ferris RL,
    15. Altschuler DL,
    16. Nikiforov YE
    : Identification of the transforming STRN-ALK fusion as a potential therapeutic target in the aggressive forms of thyroid cancer. Proc Natl Acad Sci U S A 111(11): 4233-4238, 2014. DOI: 10.1073/pnas.1321937111
    OpenUrlAbstract/FREE Full Text
  26. ↵
    1. Deshimaru M,
    2. Kinoshita-Kawada M,
    3. Kubota K,
    4. Watanabe T,
    5. Tanaka Y,
    6. Hirano S,
    7. Ishidate F,
    8. Hiramoto M,
    9. Ishikawa M,
    10. Uehara Y,
    11. Okano H,
    12. Hirose S,
    13. Fujioka S,
    14. Iwasaki K,
    15. Yuasa-Kawada J,
    16. Mishima T,
    17. Tsuboi Y
    : DCTN1 binds to TDP-43 and regulates TDP-43 aggregation. Int J Mol Sci 22(8): 3985, 2021. DOI: 10.3390/ijms22083985
    OpenUrlCrossRefPubMed
  27. ↵
    1. Schroer TA
    : Dynactin. Annu Rev Cell Dev Biol 20(1): 759-779, 2004. DOI: 10.1146/annurev.cellbio.20.012103.094623
    OpenUrlCrossRefPubMed
  28. ↵
    1. Amano Y,
    2. Ishikawa R,
    3. Sakatani T,
    4. Ichinose J,
    5. Sunohara M,
    6. Watanabe K,
    7. Kage H,
    8. Nakajima J,
    9. Nagase T,
    10. Ohishi N,
    11. Takai D
    : Oncogenic TPM3-ALK activation requires dimerization through the coiled-coil structure of TPM3. Biochem Biophys Res Commun 457(3): 457-460, 2015. DOI: 10.1016/j.bbrc.2015.01.014
    OpenUrlCrossRefPubMed
  29. ↵
    1. Cerrato A,
    2. Visconti R,
    3. Celetti A
    : The rationale for druggability of CCDC6-tyrosine kinase fusions in lung cancer. Mol Cancer 17(1): 46, 2018. DOI: 10.1186/s12943-018-0799-8
    OpenUrlCrossRefPubMed
  30. ↵
    1. Kohno T,
    2. Ichikawa H,
    3. Totoki Y,
    4. Yasuda K,
    5. Hiramoto M,
    6. Nammo T,
    7. Sakamoto H,
    8. Tsuta K,
    9. Furuta K,
    10. Shimada Y,
    11. Iwakawa R,
    12. Ogiwara H,
    13. Oike T,
    14. Enari M,
    15. Schetter AJ,
    16. Okayama H,
    17. Haugen A,
    18. Skaug V,
    19. Chiku S,
    20. Yamanaka I,
    21. Arai Y,
    22. Watanabe S,
    23. Sekine I,
    24. Ogawa S,
    25. Harris CC,
    26. Tsuda H,
    27. Yoshida T,
    28. Yokota J,
    29. Shibata T
    : KIF5B-RET fusions in lung adenocarcinoma. Nat Med 18(3): 375-377, 2012. DOI: 10.1038/nm.2644
    OpenUrlCrossRefPubMed
  31. ↵
    1. Elshenawy MM,
    2. Canty JT,
    3. Oster L,
    4. Ferro LS,
    5. Zhou Z,
    6. Blanchard SC,
    7. Yildiz A
    : Cargo adaptors regulate stepping and force generation of mammalian dynein-dynactin. Nat Chem Biol 15(11): 1093-1101, 2019. DOI: 10.1038/s41589-019-0352-0
    OpenUrlCrossRefPubMed
  32. ↵
    1. Urnavicius L,
    2. Lau CK,
    3. Elshenawy MM,
    4. Morales-Rios E,
    5. Motz C,
    6. Yildiz A,
    7. Carter AP
    : Cryo-EM shows how dynactin recruits two dyneins for faster movement. Nature 554(7691): 202-206, 2018. DOI: 10.1038/nature25462
    OpenUrlCrossRefPubMed
  33. ↵
    1. Calco GN,
    2. Stephens OR,
    3. Donahue LM,
    4. Tsui CC,
    5. Pierchala BA
    : CD2-associated protein (CD2AP) enhances casitas B lineage lymphoma-3/c (Cbl-3/c)-mediated Ret isoform-specific ubiquitination and degradation via its amino-terminal Src homology 3 domains. J Biol Chem 289(11): 7307-7319, 2014. DOI: 10.1074/jbc.M113.537878
    OpenUrlAbstract/FREE Full Text
  34. ↵
    1. Hyndman BD,
    2. Crupi MJF,
    3. Peng S,
    4. Bone LN,
    5. Rekab AN,
    6. Lian EY,
    7. Wagner SM,
    8. Antonescu CN,
    9. Mulligan LM
    : Differential recruitment of E3 ubiquitin ligase complexes regulates RET isoform internalization. J Cell Sci 130(19): 3282-3296, 2017. DOI: 10.1242/jcs.203885
    OpenUrlAbstract/FREE Full Text
Back to top

In this issue

Print
Download PDF
Article Alerts
Email Article
Citation Tools
Reprints and Permissions
Activation of DCTN1-RET Fusion Through Coiled-coil Domain as a Potential Target for RET Inhibitors
KOHEI HAYASHI, KEIJI ISHIDA, MASANORI KATO, SHUICHI OHKUBO, YOSHIHIRO UTO
Anticancer Research Apr 2025, 45 (4) 1407-1417; DOI: 10.21873/anticanres.17526
Twitter logo Facebook logo Mendeley logo

Jump to section

Keywords