Research ArticleExperimental Studies
Open Access

Ivermectin Enhances Paclitaxel Efficacy by Overcoming Resistance Through Modulation of ABCB1 in Non-small Cell Lung Cancer

ANNA HAYASHI, KOICHIRO KAMIO, AKIHIKO MIYANAGA, KEISUKE YOSHIDA, RINTARO NORO, KUNIKO MATSUDA, TAKEHIRO TOZUKA, MIWAKO OMORI, MARIKO HIRAO, AYA FUKUIZUMI, KAKERU HISAKANE, SUSUMU TAKEUCHI, MASARU MATSUMOTO, KAZUO KASAHARA, TAKANORI AMANO, KAZUFUMI HONDA and MASAHIRO SEIKE
Anticancer Research December 2024, 44 (12) 5271-5282; DOI: https://doi.org/10.21873/anticanres.17355

Abstract

Background/Aim: Chemoresistance to paclitaxel (PTX) significantly ameliorates therapeutic efficacy in patients with non-small cell lung cancer (NSCLC), especially in advanced stages, deteriorating the progression free and overall survival rates. One of the critical mechanisms contributing to drug resistance is the excretion of PTX from target cells via efflux pumps. Ivermectin was developed as a bactericidal agent against parasites; however, it has recently been shown to inhibit the proliferation of human cancer cells. Hence, we aimed to evaluate the therapeutic potential of ivermectin in combination with PTX and investigate the molecular mechanisms by which ivermectin overcomes PTX resistance. Materials and Methods: We assessed the antitumor effects of ivermectin in A549 cells treated with or without PTX. We also established PTX-resistant cells using this cell line and explored the underlying mechanisms. Additionally, we evaluated whether ivermectin attenuates PTX-resistance with the retrieval of drug sensitivity. Results: Combined treatment of A549 cells with PTX and ivermectin inhibited cell growth. These cells acquired chemoresistance upon long-term exposure to gradually increasing PTX concentrations, which was accompanied by ABCB1 mRNA up-regulation, and subsequent overproduction of P-glycoprotein (P-gp). Consistent with this, P-gp over-expression resulted in a PTX-resistant phenotype. Notably, the simultaneous ivermectin treatment during the gradual exposure completely abolished P-gp expression, leading to an increased intracellular PTX concentration and sustained PTX sensitivity. Ivermectin was found to regulate P-gp expression via the EGFR/ERK/Akt/NF-Embedded ImageB pathway. Conclusion: Combined treatment of PTX-resistant A549 cells with ivermectin and PTX may circumvent PTX resistance caused by P-gp induction, highlighting a novel therapeutic avenue for drug repurposing.

Key Words:

As one of the most prevalent malignant tumors, lung cancer is associated with high mortality and morbidity. According to cancer statistics, there were approximately 2.48 million newly diagnosed cases and 1.81 million deaths worldwide in 2022 (1). Chemotherapy remains the primary treatment option for patients with lung cancer who are ineligible for surgery or radiotherapy. Despite extensive advances in targeted molecular therapy and immunotherapy, cytotoxic agents continue to play a pivotal role in the clinical management of non-small cell lung cancer (NSCLC), a major subtype of lung cancer, especially in patients with advanced stages (2-4). However, the acquisition of chemoresistance toward these agents severely reduces therapeutic efficacy.

Cancer chemotherapy is impeded by drug resistance, which is derived from either the intrinsic resistance of tumor cells to drug action or the selection of cells capable of circumventing the drug action despite the initial response (5). The latter comprises several mechanisms, including decreased drug uptake into cells, increased drug efflux, activation of detoxifying enzymes (e.g., cytochrome P450), activation of the DNA repair system, and inhibition of apoptotic signaling pathways (6). Notably, drug efflux is a crucial strategy employed by cancer cells for survival and ATP-binding cassette (ABC) transporters function as efflux pumps, enabling cancer cells to excrete substrates through cellular membranes (7, 8). ABC transporter proteins, encoded by seven ABC genes (ABCA-ABCG), contain two domains: the transmembrane domain (TMD) and the nucleotide-binding domain (9). P-glycoprotein (P-gp) is translated from the ABCB1 gene, consisting of 14 targeted binding sites, including 12 TMDs and two ATP-binding sites (10). In several different cancer cells, P-gp actively pumps drugs out of the cells, decreasing their efficacy, thereby inducing cancer resistance. Therefore, modulating P-gp expression using potent inhibitors appears to be a promising therapeutic strategy for circumventing multidrug resistance (MDR).

Ivermectin belongs to the group of avermectins, which is a group of 16-membered macrocyclic lactone compounds discovered in 1967 in the Kitasato Institute in Japan (11). Ivermectin was found to be especially effective against a variety of diseases caused by parasites, including onchocerciasis, lymphatic filariasis, and malaria (12-14). Besides these bactericidal effects, ivermectin has recently been reported to inhibit the growth of human cancer cells (11, 15-17). In addition, ivermectin has been suggested to inhibit P-gp, implicating its inherent properties in overcoming MDR (18-20). However, whether these findings are applicable to lung cancer cells has yet to be determined.

We herein hypothesized that ivermectin regulates lung cancer growth by modulating P-gp expression and cell growth. To validate this hypothesis, we assessed the effect of ivermectin on cell proliferation using the adenocarcinoma cell line A549 in combination with the cytotoxic agent paclitaxel (PTX), a member of the taxane family that binds to microtubules and interferes with mitotic processes (21). We also established PTX-resistant cells using this cell line, and evaluated the effect of ivermectin on P-gp expression and recovery from PTX resistance. Furthermore, we investigated the regulatory mechanisms by which ivermectin controls P-gp expression. Based on our extensive research experiences on ABCB1 and lung cancer chemoresistance (22, 23), elucidating the pivotal role of ivermectin in lung cancer cells with an MDR phenotype could provide novel insights into chemoresistance and warrants further exploration towards identifying potential therapeutic targets for this refractory disorder.

Materials and Methods

Cell culture. We obtained the A549 human lung adenocarcinoma cell line from the Japanese Collection of Research Bioresources Cell Bank (Osaka, Japan). This cell line was cultured in RPMI-1640 (FUJIFILM, Osaka, Japan) supplemented with 10% fetal bovine serum (FBS; Biosera, Cholet, France) and 1% penicillin and streptomycin (FUJIFILM) at 37°C in a 5% CO2 incubator. This sample was obtained in 2021 and routinely examined for the absence of mycoplasma.

Drugs and cell viability assay. Ivermectin was purchased from FUJIFILM. PTX, U0126, SC75741, and tariquidar were purchased from Selleck Chemicals (Houston, TX, USA). Elacridar was purchased from Santa Cruz Biotechnology (Dallas, TX, USA). The effects of PTX and ivermectin on A549 cells were assessed with a tetrazolium (MTS) assay as previously described (22, 24-26). Briefly, cell suspensions (5,000 cells/well) were seeded into 96-well plates, and increasing concentrations of drugs or vehicle (dimethyl sulfoxide) were added. After incubation at 37°C for 72 h, 10% Cell Counting Kit-8 (Dojindo, Kumamoto, Japan) was added to each well and cells were further incubated at 37°C for 60 min. After shaking the plate, absorbance was measured at a test wavelength of 450 nm using a microplate reader (Infinite M200 PRO; Tecan Group Ltd., Männedorf, Switzerland). The IC50 value was defined as the concentration of PTX or ivermectin required for 50% reduction in growth. All experiments were independently repeated at least thrice.

Apoptosis assay. A549 cells (2×105 cells/well) were seeded onto six-well plates in medium containing PTX with or without ivermectin, and incubated at 37°C in 5% CO2. After 96 h of incubation, cells were trypsinized, collected, and stained with fluorescein isothiocyanate (FITC)-conjugated annexin V and propidium iodide (PI) using an apoptosis detection kit (Nacalai Tesque Inc., Kyoto, Japan) according to the manufacturer’s protocol. A total of 10,000 cells were acquired with the BD FACSVerse flow cytometer (Becton Dickinson, Franklin Lakes, NJ, USA). Analyses were performed with Flow Jo software ver.10.2 (Becton Dickinson). The percentage of total apoptotic cells, which were both Annexin V positive and Annexin V/PI double positive cells, was calculated (23).

Western blot analysis. Protein samples were lysed in a buffer containing 50 mM Tris-HCl (pH 7.6), 150 mM NaCl, 0.1% sodium dodecyl sulfate, 1% Nonidet P-40, and 0.5% sodium deoxycholate. Western blotting was performed as previously described (25, 27). The membranes were incubated with the following primary antibodies. Antibodies against P-gp (#22336-1-AP) were purchased from Proteintech (Rosemont, IL, USA). Antibodies against epidermal growth factor (EGF) Receptor (EGFR; #2232), phospho-EGF Receptor (Tyr1068) (p-EGFR; #2234), Akt (Akt; #9272), phospho-Akt (Ser473) (p-Akt; #9271), p44/42 MAPK (Erk1/2) (Erk; #9102), phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (p-Erk; #9101), nuclear factor-Embedded ImageB (NF-Embedded ImageB) p65 (D14E12) XP (NF-Embedded ImageB; #8242), and phospho-NF-Embedded ImageB p65 (Ser536) (95H1) (p-NF-Embedded ImageB; #3033) were purchased from Cell Signaling Technology (Danvers, MA, USA). Antibodies against glyceraldehyde-3-phosphate dehydrogenase (GAPDH; #sc-47724) were purchased from Santa Cruz Biotechnology. Goat Anti-Rabbit IgG-HRP (#4030-05) or Goat Anti-Mouse IgG1-HRP (#1071-05) were used as secondary antibodies and purchased from Southern Biotech (Birmingham, AL, USA). Quantification was performed by densitometry using the ImageJ software (National Institutes of Health, Bethesda, MD, USA).

Preparation of cell-line stably overexpressing ABCB1 using A549 cells. To prepare a targeting plasmid against Adeno-Associated Virus Integration Site 1 (AAVS1), a safe harbor locus in humans, pX330-U6-Chimeric_BB-CBh-hSpCas9 (pX330, #42230; Addgene, Watertown, MA, USA) was used. After digestion of pX330 with BbsI (R3539; NEB, Ipswich, MA, USA), the following sense and anti-sense strands of oligo ssDNA were annealed and inserted as spacer sequences targeting the AAVS1 locus (sense strand: CACC GTCACCAATCCTGTCCCTAG, anti-sense stand: AAACCTAG GGACAGGATTGGTGAC) (28). This vector was treated as pX330-AAVS1. For the donor vector of the genomic integration of ABCB1 into the AAVS1 locus, the ABCB1 protein-coding sequence was obtained from the A549 cell line. Total RNA was extracted from A549 cells using Trizol reagent (#15596026; Thermo Fisher Scientific, Waltham, MA, USA), and the protein-coding sequence of ABCB1 mRNA was cloned by RT-PCR using the SuperScript IV One-Step RT-PCR System (#12595025; Thermo Fisher Scientific) with the following primers (ABCB1 sequences are underlined): ABCB1_CDS_F: TCTGCAGTCGACGCCACCATGGATCTTGAAGGGGACCG, ABCB1_CDS_R: AGCGGGTTTAAACTCGAGTCACTGGCGCTTTGTTCC. The PCR product was seamlessly inserted into the AAVS1 hPGK-PuroR-pA donor (#22072; Addgene) using the NEBuilder HiFi DNA Assembly Kit (E2621; NEB). This vector was treated as pAAVS1-ABCB1. For integration of the ABCB1 transgene into the AAVS1 locus, 105 cells of A549 were transfected with 0.15 μg of pX330-AAVS1 and 0.45 μg of pAAVS1-ABCB1 using the Neon Transfection System (MPK5000; Thermo Fisher Scientific). Two days after transfection, the cells were continuously cultured in medium with puromycin (3.0 μg/ml) for one week, and then maintained in normal medium. After cloning the cells by limiting dilution, the genotype of AAVS1 locus in each clone was determined by PCR using the following primers: AAVS1_Geno_F1: CGGTCCTGGACTTTGTCTCC, AAVS1_Geno _R1: CGAACGGA CGTGAAGAATGTG, AAVS1_Geno_F2: GATGAAGCCACGTC AGCTCT, AAVS1_Geno_R2: GGCCACG TAACCTGAGAAGG.

RNA extraction and quantitative real-time reverse transcription-PCR. Total RNA was extracted from cultured cells using the Isogen reagent (Nippon Gene, Tokyo, Japan), and its concentration was determined using a NanoDrop 2000 (Thermo Fisher Scientific). RNA was reverse-transcribed to cDNA using the ReverTra Ace qPCR RT Master Mix (Toyobo, Osaka, Japan) according to the manufacturer’s instructions. The primers, cDNA, and THUNDERBIRD Probe qPCR Mix (Toyobo) were mixed, and qPCR was performed using the 7500 Fast Real-Time PCR System (Applied Biosystems, San Francisco, CA, USA). ABCB1 (Hs00184500) gene expression was measured using the TaqMan Gene Expression Assay (Thermo Fisher Scientific) and compared to GAPDH (Hs02786624) gene expression as an internal control. The gene expression levels were quantified using the 2−ΔΔCt method.

Establishment of PTX-resistant cells. The establishment of PTX-resistant A549 cells were performed using a stepwise method, as previously described (29, 30). Briefly, the cells were treated with gradient PTX concentrations (1, 1.5, 3, 5, 7.5, 10, 20, 40, 60, 80, 100, and 120 nM) for 16 weeks (wks). We named the PTX-resistant cells A549/PTXR.

Measurement of the intracellular PTX concentration using liquid chromatography-tandem mass spectrometry (LC-MS/MS). Samples were separated chromatographically on an ACQUITY Premier UPLC system (Waters Corporation, Milford, MA, USA). The separation was performed at 40°C with an Acquity BEH C18 (1.7 μm, 2.1×50 mm, Waters Corporation). The mobile phase had a flow of 0.4 ml/min and the injection volume was 5 μl. Mass analysis was performed using a QTRAP 6500+ (SCIEX, Tokyo, Japan) in the multiple reaction monitoring (MRM) mode (31, 32).

Statistical analysis. Data were expressed as the mean±standard error (SE) of three independent experiments, unless otherwise stated. Differences between the mean values of two groups were evaluated using an unpaired Student’s t-test. Differences between three or more groups were evaluated using one-way analysis of variance (ANOVA), followed by Tukey’s test. A p-value <0.05 was considered statistically significant. Analyses were performed using SPSS statistical software (version 29, IBM, Chicago, IL, USA).

Results

The combination of PTX and ivermectin synergistically induces cell death in NSCLC cells. Initially, we examined the effects of PTX and ivermectin on the proliferation of A549 cells using the MTS assay. This cell line was highly sensitive to PTX with an IC50 value of 0.0027±0.00023 μM. Ivermectin was also a potent inhibitor of cell proliferation, with an IC50 value of 4.29±0.768 μM. Subsequently, we compared the anti-proliferative effects of the combination treatment with PTX and ivermectin. As expected, PTX in combination with ivermectin exhibited a significant anti-proliferative effect on A549 cells when compared with either treatment alone (Figure 1A). Furthermore, this was corroborated by enhanced apoptotic activity as documented by increased proportions of annexin V-positive cells (Figure 1B).

Figure 1.
Figure 1.

Effect of the combination of paclitaxel (PTX) and ivermectin on cell viability in A549 cells. (A) A549 cells were incubated with PTX (0.001 μM) or ivermectin (3 μM), or the combination for 72 h. The anti-proliferative effect of the combination treatment was increased relative to PTX or ivermectin alone. *p<0.001, **p=0.008, and ***p=0.006 by one-way ANOVA followed by Tukey-Kramer’s test. (B) Apoptosis assay performed using an Annexin V-FITC Apoptosis Detection Kit. The percentages of apoptotic cells were higher with combination treatment. *p=0.002 and **p=0.001 by one-way ANOVA followed by Tukey–Kramer’s test.

Ivermectin attenuates P-gp expression in A549 cells via the inhibition of EGFR/ERK/Akt/NF-Embedded ImageB pathway. Besides an anti-microbial effect, ivermectin has been shown to inhibit P-gp expression in several solid and hematologic tumor cell lines, including colorectal and breast cancer, and chronic myeloid leukemia cells (20). Based on these observations, we tested whether ivermectin similarly decreases P-gp expression in A549 cells. As illustrated in Figure 2A, P-gp expression was hindered in response to ivermectin treatment in a concentration-dependent manner. Previous studies have demonstrated that EGFR signaling regulates P-gp expression (33, 34). Accordingly, to evaluate whether EGFR signaling is involved in P-gp expression and ivermectin-induced P-gp down-regulation, we assessed the changes in EGFR phosphorylation using western blotting. As shown in Figure 2B, EGFR activation was inhibited by ivermectin and this was highlighted when co-treated with PTX. We then evaluated the molecules located downstream of EGFR. The levels of phosphorylated ERK and Akt were found to be markedly reduced by ivermectin treatment as determined by western blotting (Figure 2B). NF-Embedded ImageB is also known to be involved in the regulation of P-gp expression and the drug resistance in tumor cells (35). Consistently, NF-Embedded ImageB phosphorylation was also attenuated by ivermectin treatment (Figure 2B). Notably, U0126 and SC75741, an MEK inhibitor that hinders ERK activity and an NF-Embedded ImageB inhibitor, respectively, attenuated P-gp expression (Figure 2C).

Figure 2.
Figure 2.

P-glycoprotein (P-gp) down-regulation by ivermectin and the relevant signaling pathways. (A) A549 cells were incubated with ivermectin with the concentrations indicated. Ivermectin attenuated P-gp expression in a concentration dependent manner. (B) Ivermectin (3 μM) hindered the EGFR, ERK, Akt, and NF-Embedded ImageB phosphorylation in A549 cells and this was emphasized when co-treated with PTX (0.001 μM). (C) A549 cells were treated with either U0126 (10 μM) and SC75741 (10 μM), an MEK inhibitor that inhibits ERK activity and an NF-Embedded ImageB inhibitor, respectively, for 72 h. These inhibitors attenuated P-gp expression.

Effect of inhibition of ABC transporters on PTX-induced NSCLC cell death. Subsequently, we assessed whether the ABCB1 and ABCG2 inhibitors, elacridar and tariquidar, enhance the therapeutic effects of PTX. A549 cells were cultured with either elacridar or tariquidar along with PTX. Elacridar partially accelerated the effects of PTX (Figure 3A), whereas tariquidar did not affect cell viability (Figure 3B).

Figure 3.
Figure 3.

Effect of elacridar and tariquidar on cell viability in A549 cells treated with paclitaxel (PTX). A549 cells were incubated with PTX in combination with either elacridar (0.5 μM) (A) or tariquidar (1 μM) (B) for 72 h. Elacridar partially accelerated the effect of PTX; however, tariquidar had no effect on cell viability. *p=0.04, **p=0.008 compared to control cells.

Long-term exposure to PTX and up-regulation of ABCB1 expression in A549 cells. Since chemoresistance generally develops after long-term exposure to agents, we continuously exposed A549 cells to gradually increasing concentrations of PTX for up to 16 weeks (wks). As illustrated in Figure 4A, the A549/PTXR cells exhibited an apparent chemoresistant phenotype compared to the parental cells. These changes were accompanied by a robust increase in ABCB1 gene expression, reaching up to 80 times the baseline levels (Figure 4B). Notably, this was followed by a decrease in PTX concentration in PTX-resistant cells (Figure 4C).

Figure 4.
Figure 4.

P-glycoprotein (P-gp) up-regulation is implicated in acquired resistance to paclitaxel (PTX) in A549 cells. (A) MTS assays showing that A549 cells exposed to PTX for 16 weeks in a step-wise method developed a PTX-resistant phenotype. *p=0.027, **p=0.004, and ***p=0.006 compared to control cells. (B) ABCB1 mRNA expression was up-regulated in A549/PTXR cells compared with parental A549 cells, from 1.0 to 82.24. *p<0.001 by Student’s t-test. (C) Intracellular PTX concentration was determined using LC-MS/MS method both in parental A549 and A549/PTXR cells after cultured for 72 h. *p<0.001 by Student’s t-test. A549/PTXR; PTX-resistant A549 cells.

Effect of over-expression of ABCB1 in A549 cells on PTX-induced cell death. To explore the roles of P-gp, we generated a cell line that could stably over-express ABCB1 with genome editing. The structure of the vector pAAVS1-ABCB1 is shown in Figure 5A. The exogenous expression of ABCB1 is confirmed at mRNA levels by qRT-PCR (Figure 5B). Using this cell line, we compared the cell viability in response to PTX between parental and three clones of ABCB1 over-expressing A549 cells. As shown in Figure 5C-E, A549 cells over-expressing ABCB1 exhibited PTX resistance.

Figure 5.
Figure 5.

Effect of ABCB1 over-expression on paclitaxel (PTX)-induced cell death. (A) The structure of the final construct in pAAVS1-ABCB1 donor vector. The positions of binding sites of primers for genotyping the AAVS1 locus, are also indicated. (B) The representative data of genotyping of the AAVS1 locus by qRT-PCR with AAVS1_Geno primers. (C-E) Parental and ABCB1 over-expressing A549 cells were treated with PTX and the cell viability was assessed. ABCB1 over-expression exhibited PTX-resistant phenotype. *p<0.05 compared to parental cells.

Simultaneous ivermectin treatment hinders ABCB1 up-regulation induced by PTX prolonged exposure. The aforementioned data prompted us to investigate whether simultaneous administration of ivermectin during long-term PTX exposure could inhibit the increase in P-gp expression, thus preventing the development of chemoresistance to PTX. To test this hypothesis, A549 cells were continuously treated with ivermectin during the induction of PTX-resistance using a stepwise method. As depicted in Figure 6A, the attenuation of P-gp expression by concurrent ivermectin treatment was sustained until 16 weeks of PTX exposure. Consistent with this, PTX-sensitivity was maintained in A549 cells via simultaneous ivermectin treatment with significantly lower IC50 values compared to cells cultured with PTX alone by 16 weeks (4 wks; 0.004±0.0001 vs. 0.130±0.068 μM, 8 wks; 0.010±0.0003 vs. 0.132±0.025 μM, 12 wks; 0.007±0.001 vs. 0.266±0.047 μM, 16 wks; 0.013±0.006 vs. 0.331±0.011 μM) (Figure 6B). As expected, the intracellular PTX concentration was significantly increased in A549 cells co-treated with ivermectin (Figure 6C). EGFR activation was inhibited by ivermectin co-treatment in A549/PTXR cells, followed by ERK and Akt inactivation (Figure 6D). The same was observed for NF-Embedded ImageB phosphorylation induced by long-term PTX exposure (Figure 6D).

Figure 6.
Figure 6.

Effect of ivermectin on P-glycoprotein (P-gp) expression induced by paclitaxel (PTX) long-term exposure. (A) A549 cells were cultured with ivermectin in a constant concentration (3 μM) during the induction of PTX-resistance. Ivermectin treatment almost completely abolished P-gp induction. (B) MTS assays showed that A549 cells co-cultured with ivermectin during the establishment of PTX-resistant cells were kept significantly sensitive to PTX at every time point examined until 16 weeks (wks). *p<0.05 when compared to A549 cells cultured with PTX alone. (C) A549 cells cultured with PTX using a step-wise method, with or without ivermectin, were treated with PTX (0.001 μM) for 72 h. Then, intracellular concentration of PTX was measured by the LC-MS/MS method. Intracellular PTX concentration significantly increased with ivermectin co-treatment. *p=0.006 by Student’s t-test. (D) Ivermectin inhibited the EGFR, ERK, Akt, and NF-Embedded ImageB phosphorylation in A549/PTXR cells. A549/PTXR; PTX-resistant A549 cells.

Discussion

In the current study, we demonstrated that chemoresistance upon long-term exposure to a stepwise increase in PTX was attributed to ABCB1 up-regulation accompanied by P-gp over-expression, which was ameliorated by concurrent ivermectin treatment, sustaining sensitivity to PTX with increased intracellular PTX concentration. Additionally, ivermectin itself showed antitumor effects on A549 cells. P-gp expression was regulated by ivermectin via the inhibition of the EGFR/ERK/Akt/NF-Embedded ImageB pathway, and its over-expression led to PTX resistance. Our findings support the use of ivermectin in patients with NSCLC to overcome PTX resistance attributed to an excessive P-gp induction.

Lung cancer treatment was initially restricted to cytotoxic chemotherapy with platinum compounds associated with 3rd generation cytotoxic agents, such as PTX, gemcitabine, and pemetrexed. Among them, PTX is one of the key drugs used as a platinum doublet and has been positioned as a standard regimen for advanced NSCLC in several past trials (36, 37). Moreover, the widely used nanoparticle albumin-bound form of PTX (nab-PTX) is less toxic, with promising pharmacological improvements (38), providing efficacy in patients with previously treated advanced NSCLC (39) or in the elderly population with NSCLC (40).

Despite these treatment benefits, resistance to PTX or nab-PTX is developed and acquired after several courses of administration via various mechanisms, which include the alterations of the target molecule β-tubulin of mitosis (41), changes in molecular mechanisms that activate drug efflux out of cells (8), and over-expression of Bcl-2 (42). Overproduction of mutant p53 (43) and spontaneous mutations (44) have also been noted as mechanisms of resistance to the taxane family. Among these, we observed a robust increase in P-gp levels in A549 cells as a result of stepwise exposure to PTX, followed by accelerated drug efflux, thereby highlighting the acquisition of the PTX-resistant phenotype. Therefore, targeting P-gp is considered a therapeutic strategy for retrieving sensitivity to chemotherapeutic agents. This is supported by an observation that PTX sensitivity is associated with ABCB1 down-regulation induced by long-term exposure to everolimus in renal cell carcinoma cells (45).

Based on this concept, many inhibitors of P-gp have been developed to test in clinical trials in patients with resistant cancers. The first studies on ABCB1 were performed using first-generation drugs, such as verapamil (46, 47). However, high doses were required to inhibit ABC transporters, which was associated with serious adverse events. Second- and third-generation ABC transporter inhibitors (e.g., elacridar and tariquidar) are significantly more potent than first-generation agents and are therefore used at much lower doses. Phase I studies demonstrated that the combination of elacridar and oral topotecan resulted in complete oral bioavailability of topotecan (48). Studies on tariquidar in combination with vinorelbine or docetaxel showed no significant adverse events or pharmacokinetic interactions (49, 50). However, two large phase III trials evaluating tariquidar combined with first-line chemotherapy for patients with NSCLC were terminated early because of toxicity (47, 51, 52). This was, in part, due to increased adverse events caused by the chemotherapeutic agents, whose concentration in normal cells was increased by the blockade of physiological drug efflux (51, 53, 54). Therefore, there is an urgent need to develop P-gp inhibitors for the clinical treatment of drug-resistant cancers. Ivermectin has been reported as an anti-cancer agent (11, 15, 16), and we also observed this effect in a lung adenocarcinoma cell line, as well as sustained inhibition of P-gp in PTX-resistant cells. Taking this dual action of ivermectin into account, a clinical trial can be designed in which ivermectin is administered both therapeutically and prophylactically to patients with NSCLC treated with PTX regimens.

In this study, we found that NF-Embedded ImageB is involved in the regulation of ABCB1 and that its activation is inhibited by ivermectin in both parental and PTX-resistant A549 cells. This finding was supported by an NF-Embedded ImageB inhibitor, SC75741, which down-regulated P-gp expression. NF-Embedded ImageB signaling has critical roles in various cellular processes, including apoptosis, proliferation, response to DNA damage, and immune function. Hence, numerous human diseases, such as autoimmune or inflammatory disorders and tumors, are closely linked to NF-Embedded ImageB activation (55). Thus, targeting NF-Embedded ImageB signaling contributes to the alleviation of these pathological conditions. When considering the involvement of NF-Embedded ImageB in tumorigenesis, it is plausible expecting ivermectin not only to inhibit tumor proliferation by directly targeting NF-Embedded ImageB but also to down-regulate ABCB1 as a result of NF-Embedded ImageB inhibition, providing novel therapeutics for patients with advanced NSCLC.

Moreover, the inherent anti-inflammatory properties of ivermectin (56-58) support its use in interstitial lung diseases (ILDs). Idiopathic pulmonary fibrosis (IPF) is a devastating form of ILD, and is associated with an increased risk of lung cancer, with cumulative incidence rates of 3.3% and 15.4% at 1 and 5 years of follow-up, respectively (59). Patients with IPF complicated by lung cancer exhibit a worse prognosis than those with IPF alone because of the progression of lung cancer and complications arising from cancer treatment (60-64). However, the potency of ivermectin in lung injuries (65-67) together with the data presented in this article, provide insights toward the novel application of this agent in patients with IPF and lung cancer.

Study limitations. First, we examined the effects of PTX using only one lung adenocarcinoma cell line, A549. Therefore, further studies using other lung adenocarcinoma or squamous cell carcinoma cell lines should be conducted in order to evaluate whether these observations apply to a broader array of patients with lung cancer. Likewise, given the numerous anticancer drugs available for lung cancer, agents other than PTX should be tested. Secondly, this study was conducted only in vitro. Further studies using animal models or clinical samples are required to validate ivermectin as a novel therapeutic option for patients with lung cancer.

Conclusion

In conclusion, our findings provide a novel therapeutic approach for patients with advanced-stage NSCLC, avoiding the development of chemoresistance with the concurrent administration of ivermectin. This will enhance the efficacy of cytotoxic agents, thus warranting further investigations, including clinical challenges.

Acknowledgements

The Authors thank FUJIFILM Toyama Chemical Co., Ltd. (Tokyo, Japan) for their technical support on measurement of intracellular drug concentration.

Footnotes

  • Authors’ Contributions

    Conception and design: A. Hayashi, K. Kamio, A. Miyanaga, M. Seike; Acquisition of data: A. Hayashi, K. Kamio, K. Yoshida, T, Amano, K. Matsuda, M. Hirao; Analysis and interpretation of data: All Authors; Drafting the manuscript or revising it critically for important intellectual content: A. Hayashi, K. Kamio, K. Yoshida, M. Seike; Final approval of the version to be published: All Authors; Agreement to be accountable for all aspects of the work: All Authors.

  • Conflicts of Interest

    The Authors have no conflicts of interest to declare in relation to this study.

  • Funding

    This study was supported by JSPS KAKENHI (grant number: 17KK0177 to Rintaro Noro). The funder had no role in the conceptualization, design, data collection, analysis, decision to publish, or preparation of the manuscript.

  • Received October 12, 2024.
  • Revision received October 19, 2024.
  • Accepted October 21, 2024.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY-NC-ND) 4.0 international license (https://creativecommons.org/licenses/by-nc-nd/4.0).

References

  1. ↵
    1. Bray F,
    2. Laversanne M,
    3. Sung H,
    4. Ferlay J,
    5. Siegel RL,
    6. Soerjomataram I,
    7. Jemal A
    : Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 74(3): 229-263, 2024. DOI: 10.3322/caac.21834
    OpenUrlCrossRef
  2. ↵
    1. Herbst RS,
    2. Morgensztern D,
    3. Boshoff C
    : The biology and management of non-small cell lung cancer. Nature 553(7689): 446-454, 2018. DOI: 10.1038/nature25183
    OpenUrlCrossRefPubMed
    1. Singh T,
    2. Fatehi Hassanabad M,
    3. Fatehi Hassanabad A
    : Non-small cell lung cancer: Emerging molecular targeted and immunotherapeutic agents. Biochim Biophys Acta Rev Cancer 1876(2): 188636, 2021. DOI: 10.1016/j.bbcan.2021.188636
    OpenUrlCrossRef
  4. ↵
    1. Gao L,
    2. Qiao L,
    3. Li Y,
    4. Jia L,
    5. Cui W,
    6. Yang J,
    7. Wu C,
    8. Wang L
    : ALKBH5 regulates paclitaxel resistance in NSCLC via inhibiting CEMIP-mediated EMT. Toxicol Appl Pharmacol 483: 116807, 2024. DOI: 10.1016/j.taap.2024.116807
    OpenUrlCrossRefPubMed
  5. ↵
    1. Hütter G,
    2. Sinha P
    : Proteomics for studying cancer cells and the development of chemoresistance. Proteomics 1(10): 1233-1248, 2001. DOI: 10.1002/1615-9861(200110)1:10<1233::Aid-prot1233>3.0.Co;2-2
    OpenUrlCrossRefPubMed
  6. ↵
    1. Gottesman MM,
    2. Fojo T,
    3. Bates SE
    : Multidrug resistance in cancer: role of ATP–dependent transporters. Nat Rev Cancer 2(1): 48-58, 2002. DOI: 10.1038/nrc706
    OpenUrlCrossRefPubMed
  7. ↵
    1. Gottesman MM,
    2. Pastan IH
    : The role of multidrug resistance efflux pumps in cancer: Revisiting a JNCI publication exploring expression of the MDR1 (P-glycoprotein) gene. J Natl Cancer Inst 107(9): djv222, 2015. DOI: 10.1093/jnci/djv222
    OpenUrlCrossRefPubMed
  8. ↵
    1. Alalawy AI
    : Key genes and molecular mechanisms related to Paclitaxel Resistance. Cancer Cell Int 24(1): 244, 2024. DOI: 10.1186/s12935-024-03415-0
    OpenUrlCrossRefPubMed
  9. ↵
    1. Gallo JM,
    2. Li S,
    3. Guo P,
    4. Reed K,
    5. Ma J
    : The effect of P-glycoprotein on paclitaxel brain and brain tumor distribution in mice. Cancer Res 63(16): 5114-5117, 2003.
    OpenUrlAbstract/FREE Full Text
  10. ↵
    1. Samodelov SL,
    2. Kullak-Ublick GA,
    3. Gai Z,
    4. Visentin M
    : Organic cation transporters in human physiology, pharmacology, and toxicology. Int J Mol Sci 21(21): 7890, 2020. DOI: 10.3390/ijms21217890
    OpenUrlCrossRefPubMed
  11. ↵
    1. Juarez M,
    2. Schcolnik-Cabrera A,
    3. Dueñas-Gonzalez A
    : The multitargeted drug ivermectin: From an antiparasitic agent to a repositioned cancer drug. Am J Cancer Res 8(2): 317-331, 2018.
    OpenUrlPubMed
  12. ↵
    1. Anselmi M,
    2. Buonfrate D,
    3. Guevara Espinoza A,
    4. Prandi R,
    5. Marquez M,
    6. Gobbo M,
    7. Montresor A,
    8. Albonico M,
    9. Racines Orbe M,
    10. Martin Moreira J,
    11. Bisoffi Z
    : Mass administration of ivermectin for the elimination of onchocerciasis significantly reduced and maintained low the prevalence of Strongyloides stercoralis in Esmeraldas, Ecuador. PLoS Negl Trop Dis 9(11): e0004150, 2015. DOI: 10.1371/journal.pntd.0004150
    OpenUrlCrossRefPubMed
    1. King CL,
    2. Suamani J,
    3. Sanuku N,
    4. Cheng YC,
    5. Satofan S,
    6. Mancuso B,
    7. Goss CW,
    8. Robinson LJ,
    9. Siba PM,
    10. Weil GJ,
    11. Kazura JW
    : A trial of a triple-drug treatment for lymphatic filariasis. N Engl J Med 379(19): 1801-1810, 2018. DOI: 10.1056/NEJMoa1706854
    OpenUrlCrossRefPubMed
  14. ↵
    1. Pinilla YT,
    2. C P Lopes S,
    3. S Sampaio V,
    4. Andrade FS,
    5. Melo GC,
    6. Orfanó AS,
    7. Secundino NFC,
    8. Guerra MGVB,
    9. Lacerda MVG,
    10. Kobylinski KC,
    11. Escobedo-Vargas KS,
    12. López-Sifuentes VM,
    13. Stoops CA,
    14. Baldeviano GC,
    15. Tarning J,
    16. Vasquez GM,
    17. Pimenta PFP,
    18. Monteiro WM
    : Promising approach to reducing Malaria transmission by ivermectin: Sporontocidal effect against Plasmodium vivax in the South American vectors Anopheles aquasalis and Anopheles darlingi. PLoS Negl Trop Dis 12(2): e0006221, 2018. DOI: 10.1371/journal.pntd.0006221
    OpenUrlCrossRefPubMed
  15. ↵
    1. Melotti A,
    2. Mas C,
    3. Kuciak M,
    4. Lorente-Trigos A,
    5. Borges I,
    6. Ruiz i Altaba A
    : The river blindness drug Ivermectin and related macrocyclic lactones inhibit WNT-TCF pathway responses in human cancer. EMBO Mol Med 6(10): 1263-1278, 2014. DOI: 10.15252/emmm.201404084
    OpenUrlAbstract/FREE Full Text
  16. ↵
    1. Dou Q,
    2. Chen HN,
    3. Wang K,
    4. Yuan K,
    5. Lei Y,
    6. Li K,
    7. Lan J,
    8. Chen Y,
    9. Huang Z,
    10. Xie N,
    11. Zhang L,
    12. Xiang R,
    13. Nice EC,
    14. Wei Y,
    15. Huang C
    : Ivermectin induces cytostatic autophagy by blocking the PAK1/Akt axis in breast cancer. Cancer Res 76(15): 4457-4469, 2016. DOI: 10.1158/0008-5472.Can-15-2887
    OpenUrlAbstract/FREE Full Text
  17. ↵
    1. Intuyod K,
    2. Hahnvajanawong C,
    3. Pinlaor P,
    4. Pinlaor S
    : Anti-parasitic drug ivermectin exhibits potent anticancer activity against gemcitabine-resistant cholangiocarcinoma in vitro. Anticancer Res 39(9): 4837-4843, 2019. DOI: 10.21873/anticanres.13669
    OpenUrlAbstract/FREE Full Text
  18. ↵
    1. Lespine A,
    2. Dupuy J,
    3. Orlowski S,
    4. Nagy T,
    5. Glavinas H,
    6. Krajcsi P,
    7. Alvinerie M
    : Interaction of ivermectin with multidrug resistance proteins (MRP1, 2 and 3). Chem Biol Interact 159(3): 169-179, 2006. DOI: 10.1016/j.cbi.2005.11.002
    OpenUrlCrossRefPubMed
    1. Lespine A,
    2. Martin S,
    3. Dupuy J,
    4. Roulet A,
    5. Pineau T,
    6. Orlowski S,
    7. Alvinerie M
    : Interaction of macrocyclic lactones with P-glycoprotein: Structure–affinity relationship. Eur J Pharm Sci 30(1): 84-94, 2007. DOI: 10.1016/j.ejps.2006.10.004
    OpenUrlCrossRefPubMed
  20. ↵
    1. Jiang L,
    2. Wang P,
    3. Sun YJ,
    4. Wu YJ
    : Ivermectin reverses the drug resistance in cancer cells through EGFR/ERK/Akt/NF-κB pathway. J Exp Clin Cancer Res 38(1): 265, 2019. DOI: 10.1186/s13046-019-1251-7
    OpenUrlCrossRefPubMed
  21. ↵
    1. Jordan MA,
    2. Wilson L
    : Microtubules as a target for anticancer drugs. Nat Rev Cancer 4(4): 253-265, 2004. DOI: 10.1038/nrc1317
    OpenUrlCrossRefPubMed
  22. ↵
    1. Sugano T,
    2. Seike M,
    3. Noro R,
    4. Soeno C,
    5. Chiba M,
    6. Zou F,
    7. Nakamichi S,
    8. Nishijima N,
    9. Matsumoto M,
    10. Miyanaga A,
    11. Kubota K,
    12. Gemma A
    : Inhibition of ABCB1 overcomes cancer stem cell–like properties and acquired resistance to MET inhibitors in non–small cell lung cancer. Mol Cancer Ther 14(11): 2433-2440, 2015. DOI: 10.1158/1535-7163.Mct-15-0050
    OpenUrlAbstract/FREE Full Text
  23. ↵
    1. Omori M,
    2. Noro R,
    3. Seike M,
    4. Matsuda K,
    5. Hirao M,
    6. Fukuizumi A,
    7. Takano N,
    8. Miyanaga A,
    9. Gemma A
    : Inhibitors of ABCB1 and ABCG2 overcame resistance to topoisomerase inhibitors in small cell lung cancer. Thorac Cancer 13(15): 2142-2151, 2022. DOI: 10.1111/1759-7714.14527
    OpenUrlCrossRefPubMed
  24. ↵
    1. Kitamura K,
    2. Seike M,
    3. Okano T,
    4. Matsuda K,
    5. Miyanaga A,
    6. Mizutani H,
    7. Noro R,
    8. Minegishi Y,
    9. Kubota K,
    10. Gemma A
    : MiR-134/487b/655 cluster regulates TGF-β–induced epithelial–mesenchymal transition and drug resistance to gefitinib by targeting MAGI2 in lung adenocarcinoma cells. Mol Cancer Ther 13(2): 444-453, 2014. DOI: 10.1158/1535-7163.Mct-13-0448
    OpenUrlAbstract/FREE Full Text
  25. ↵
    1. Matsumoto M,
    2. Seike M,
    3. Noro R,
    4. Soeno C,
    5. Sugano T,
    6. Takeuchi S,
    7. Miyanaga A,
    8. Kitamura K,
    9. Kubota K,
    10. Gemma A
    : Control of the MYC-eIF4E axis plus mTOR inhibitor treatment in small cell lung cancer. BMC Cancer 15: 241, 2015. DOI: 10.1186/s12885-015-1202-4
    OpenUrlCrossRefPubMed
  26. ↵
    1. Takahashi A,
    2. Seike M,
    3. Chiba M,
    4. Takahashi S,
    5. Nakamichi S,
    6. Matsumoto M,
    7. Takeuchi S,
    8. Minegishi Y,
    9. Noro R,
    10. Kunugi S,
    11. Kubota K,
    12. Gemma A
    : Ankyrin repeat domain 1 overexpression is associated with common resistance to afatinib and osimertinib in EGFR-mutant lung cancer. Sci Rep 8(1): 14896, 2018. DOI: 10.1038/s41598-018-33190-8
    OpenUrlCrossRefPubMed
  27. ↵
    1. Seike M,
    2. Goto A,
    3. Okano T,
    4. Bowman ED,
    5. Schetter AJ,
    6. Horikawa I,
    7. Mathe EA,
    8. Jen J,
    9. Yang P,
    10. Sugimura H,
    11. Gemma A,
    12. Kudoh S,
    13. Croce CM,
    14. Harris CC
    : MiR-21 is an EGFR-regulated anti-apoptotic factor in lung cancer in never-smokers. Proc Natl Acad Sci USA 106(29): 12085-12090, 2009. DOI: 10.1073/pnas.0905234106
    OpenUrlAbstract/FREE Full Text
  28. ↵
    1. van der Wal E,
    2. Herrero-Hernandez P,
    3. Wan R,
    4. Broeders M,
    5. In ‘t Groen SLM,
    6. van Gestel TJM,
    7. van IJcken WFJ,
    8. Cheung TH,
    9. van der Ploeg AT,
    10. Schaaf GJ,
    11. Pijnappel WWMP
    : Large-scale expansion of human iPSC-derived skeletal muscle cells for disease modeling and cell-based therapeutic strategies. Stem Cell Reports 10(6): 1975-1990, 2018. DOI: 10.1016/j.stemcr.2018.04.002
    OpenUrlCrossRef
  29. ↵
    1. Zhou H,
    2. Wu S,
    3. Zhai S,
    4. Liu A,
    5. Sun Y,
    6. Li R,
    7. Zhang Y,
    8. Ekins S,
    9. Swaan PW,
    10. Fang B,
    11. Zhang B,
    12. Yan B
    : Design, synthesis, cytoselective toxicity, structure–activity relationships, and pharmacophore of thiazolidinone derivatives targeting drug-resistant lung cancer cells. J Med Chem 51(5): 1242-1251, 2008. DOI: 10.1021/jm7012024
    OpenUrlCrossRefPubMed
  30. ↵
    1. Li F,
    2. Zhou X,
    3. Zhou H,
    4. Jia J,
    5. Li L,
    6. Zhai S,
    7. Yan B
    : Reducing both Pgp overexpression and drug efflux with anti-cancer gold-paclitaxel nanoconjugates. PLoS One 11(7): e0160042, 2016. DOI: 10.1371/journal.pone.0160042
    OpenUrlCrossRefPubMed
  31. ↵
    1. Wang X,
    2. Wang X,
    3. Cai T,
    4. Qin Y,
    5. Li L,
    6. Jiang Y,
    7. Han B,
    8. Cao Y
    : Development and validation of a sensitive LC-MS/MS method for determination of intracellular concentration of fluconazole in Candida albicans. Front Microbiol 13: 1007576, 2022. DOI: 10.3389/fmicb.2022.1007576
    OpenUrlCrossRefPubMed
  32. ↵
    1. Feiertag K,
    2. Karaca M,
    3. Fischer B,
    4. Heise T,
    5. Bloch D,
    6. Opialla T,
    7. Tralau T,
    8. Kneuer C,
    9. Marx-Stoelting P
    : Mixture effects of co-formulants and two plant protection products in a liver cell line. EXCLI J 22: 221-236, 2023. DOI: 10.17179/excli2022-5648
    OpenUrlCrossRefPubMed
  33. ↵
    1. Xu JW,
    2. Li QQ,
    3. Tao LL,
    4. Cheng YY,
    5. Yu J,
    6. Chen Q,
    7. Liu XP,
    8. Xu ZD
    : Involvement of EGFR in the promotion of malignant properties in multidrug resistant breast cancer cells. Int J Oncol 39(6): 1501-9, 2011. DOI: 10.3892/ijo.2011.1143
    OpenUrlCrossRefPubMed
  34. ↵
    1. Hour TC,
    2. Chung SD,
    3. Kang WY,
    4. Lin YC,
    5. Chuang SJ,
    6. Huang AM,
    7. Wu WJ,
    8. Huang SP,
    9. Huang CY,
    10. Pu YS
    : EGFR mediates docetaxel resistance in human castration-resistant prostate cancer through the Akt-dependent expression of ABCB1 (MDR1). Arch Toxicol 89(4): 591-605, 2015. DOI: 10.1007/s00204-014-1275-x
    OpenUrlCrossRefPubMed
  35. ↵
    1. Bark H,
    2. Choi CH
    : PSC833, cyclosporine analogue, downregulates MDR1 expression by activating JNK/c-Jun/AP-1 and suppressing NF-κB. Cancer Chemother Pharmacol 65(6): 1131-1136, 2010. DOI: 10.1007/s00280-009-1121-7
    OpenUrlCrossRefPubMed
  36. ↵
    1. Schiller JH,
    2. Harrington D,
    3. Belani CP,
    4. Langer C,
    5. Sandler A,
    6. Krook J,
    7. Zhu J,
    8. Johnson DH
    : Comparison of four chemotherapy regimens for advanced non–small-cell lung cancer. N Engl J Med 346(2): 92-98, 2002. DOI: 10.1056/NEJMoa011954
    OpenUrlCrossRefPubMed
  37. ↵
    1. Ohe Y,
    2. Ohashi Y,
    3. Kubota K,
    4. Tamura T,
    5. Nakagawa K,
    6. Negoro S,
    7. Nishiwaki Y,
    8. Saijo N,
    9. Ariyoshi Y,
    10. Fukuoka M
    : Randomized phase III study of cisplatin plus irinotecan versus carboplatin plus paclitaxel, cisplatin plus gemcitabine, and cisplatin plus vinorelbine for advanced non-small-cell lung cancer: Four-Arm Cooperative Study in Japan. Ann Oncol 18(2): 317-323, 2007. DOI: 10.1093/annonc/mdl377
    OpenUrlCrossRefPubMed
  38. ↵
    1. Matsumura Y,
    2. Maeda H
    : A new concept for macromolecular therapeutics in cancer chemotherapy: Mechanism of tumoritropic accumulation of proteins and the antitumor agent smancs. Cancer Res 46(12 Pt 1): 6387-6392, 1986.
    OpenUrlAbstract/FREE Full Text
  39. ↵
    1. Yoneshima Y,
    2. Morita S,
    3. Ando M,
    4. Nakamura A,
    5. Iwasawa S,
    6. Yoshioka H,
    7. Goto Y,
    8. Takeshita M,
    9. Harada T,
    10. Hirano K,
    11. Oguri T,
    12. Kondo M,
    13. Miura S,
    14. Hosomi Y,
    15. Kato T,
    16. Kubo T,
    17. Kishimoto J,
    18. Yamamoto N,
    19. Nakanishi Y,
    20. Okamoto I
    : Phase 3 trial comparing nanoparticle albumin-bound paclitaxel with docetaxel for previously treated advanced NSCLC. J Thorac Oncol 16(9): 1523-1532, 2021. DOI: 10.1016/j.jtho.2021.03.027
    OpenUrlCrossRefPubMed
  40. ↵
    1. Kogure Y,
    2. Iwasawa S,
    3. Saka H,
    4. Hamamoto Y,
    5. Kada A,
    6. Hashimoto H,
    7. Atagi S,
    8. Takiguchi Y,
    9. Ebi N,
    10. Inoue A,
    11. Kurata T,
    12. Okamoto I,
    13. Yamaguchi M,
    14. Harada T,
    15. Seike M,
    16. Ando M,
    17. Saito AM,
    18. Kubota K,
    19. Takenoyama M,
    20. Seto T,
    21. Yamamoto N,
    22. Gemma A
    : Efficacy and safety of carboplatin with nab-paclitaxel versus docetaxel in older patients with squamous non-small-cell lung cancer (CAPITAL): a randomised, multicentre, open-label, phase 3 trial. Lancet Healthy Longev 2(12): e791-e800, 2021. DOI: 10.1016/s2666-7568(21)00255-5
    OpenUrlCrossRef
  41. ↵
    1. Panda D,
    2. Miller HP,
    3. Banerjee A,
    4. Ludueña RF,
    5. Wilson L
    : Microtubule dynamics in vitro are regulated by the tubulin isotype composition. Proc Natl Acad Sci USA 91(24): 11358-11362, 1994. DOI: 10.1073/pnas.91.24.11358
    OpenUrlAbstract/FREE Full Text
  42. ↵
    1. Tang C,
    2. Willingham MC,
    3. Reed JC,
    4. Miyashita T,
    5. Ray S,
    6. Ponnathpur V,
    7. Huang Y,
    8. Mahoney ME,
    9. Bullock G,
    10. Bhalla K
    : High levels of p26BCL-2 oncoprotein retard taxol-induced apoptosis in human pre-B leukemia cells. Leukemia 8(11): 1960-1969, 1994.
    OpenUrlPubMed
  43. ↵
    1. Metzinger DS,
    2. Taylor DD,
    3. Gercel-Taylor C
    : Induction of p53 and drug resistance following treatment with cisplatin or paclitaxel in ovarian cancer cell lines. Cancer Lett 236(2): 302-308, 2006. DOI: 10.1016/j.canlet.2005.05.016
    OpenUrlCrossRefPubMed
  44. ↵
    1. Dumontet C,
    2. Duran GE,
    3. Steger KA,
    4. Beketic-Oreskovic L,
    5. Sikic BI
    : Resistance mechanisms in human sarcoma mutants derived by single-step exposure to paclitaxel (Taxol). Cancer Res 56(5): 1091-1097, 1996.
    OpenUrlAbstract/FREE Full Text
  45. ↵
    1. Nakayama Y,
    2. Ino A,
    3. Yamamoto K,
    4. Takara K
    : Down-regulation of ABCB1 in everolimus-resistant renal cell carcinoma cells. Anticancer Res 44(7): 2871-2876, 2024. DOI: 10.21873/anticanres.17099
    OpenUrlAbstract/FREE Full Text
  46. ↵
    1. Szakács G,
    2. Paterson JK,
    3. Ludwig JA,
    4. Booth-Genthe C,
    5. Gottesman MM
    : Targeting multidrug resistance in cancer. Nat Rev Drug Discov 5(3): 219-234, 2006. DOI: 10.1038/nrd1984
    OpenUrlCrossRefPubMed
  47. ↵
    1. Tamaki A,
    2. Ierano C,
    3. Szakacs G,
    4. Robey RW,
    5. Bates SE
    : The controversial role of ABC transporters in clinical oncology. Essays Biochem 50(1): 209-232, 2011. DOI: 10.1042/bse0500209
    OpenUrlAbstract/FREE Full Text
  48. ↵
    1. Kuppens IE,
    2. Witteveen EO,
    3. Jewell RC,
    4. Radema SA,
    5. Paul EM,
    6. Mangum SG,
    7. Beijnen JH,
    8. Voest EE,
    9. Schellens JH
    : A phase I, randomized, open-label, parallel-cohort, dose-finding study of elacridar (GF120918) and oral topotecan in cancer patients. Clin Cancer Res 13(11): 3276-3285, 2007. DOI: 10.1158/1078-0432.Ccr-06-2414
    OpenUrlAbstract/FREE Full Text
  49. ↵
    1. Abraham J,
    2. Edgerly M,
    3. Wilson R,
    4. Chen C,
    5. Rutt A,
    6. Bakke S,
    7. Robey R,
    8. Dwyer A,
    9. Goldspiel B,
    10. Balis F,
    11. Van Tellingen O,
    12. Bates SE,
    13. Fojo T
    : A phase I study of the P-glycoprotein antagonist tariquidar in combination with vinorelbine. Clin Cancer Res 15(10): 3574-3582, 2009. DOI: 10.1158/1078-0432.CCR-08-0938
    OpenUrlAbstract/FREE Full Text
  50. ↵
    1. Kelly RJ,
    2. Draper D,
    3. Chen CC,
    4. Robey RW,
    5. Figg WD,
    6. Piekarz RL,
    7. Chen X,
    8. Gardner ER,
    9. Balis FM,
    10. Venkatesan AM,
    11. Steinberg SM,
    12. Fojo T,
    13. Bates SE
    : A pharmacodynamic study of docetaxel in combination with the P-glycoprotein antagonist tariquidar (XR9576) in patients with lung, ovarian, and cervical cancer. Clin Cancer Res 17(3): 569-580, 2011. DOI: 10.1158/1078-0432.CCR-10-1725
    OpenUrlAbstract/FREE Full Text
  51. ↵
    1. Nobili S,
    2. Landini I,
    3. Giglioni B,
    4. Mini E
    : Pharmacological strategies for overcoming multidrug resistance. Curr Drug Targets 7(7): 861-879, 2006. DOI: 10.2174/138945006777709593
    OpenUrlCrossRefPubMed
  52. ↵
    1. Fox E,
    2. Bates SE
    : Tariquidar (XR9576): a P-glycoprotein drug efflux pump inhibitor. Expert Rev Anticancer Ther 7(4): 447-459, 2007. DOI: 10.1586/14737140.7.4.447
    OpenUrlCrossRefPubMed
  53. ↵
    1. Palmeira A,
    2. Sousa E,
    3. Vasconcelos MH,
    4. Pinto MM
    : Three decades of P-gp inhibitors: Skimming through several generations and scaffolds. Curr Med Chem 19(13): 1946-2025, 2012. DOI: 10.2174/092986712800167392
    OpenUrlCrossRefPubMed
  54. ↵
    1. Joshi P,
    2. Vishwakarma RA,
    3. Bharate SB
    : Natural alkaloids as P-gp inhibitors for multidrug resistance reversal in cancer. Eur J Med Chem 138: 273-292, 2017. DOI: 10.1016/j.ejmech.2017.06.047
    OpenUrlCrossRefPubMed
  55. ↵
    1. Taniguchi K,
    2. Karin M
    : NF-κB, inflammation, immunity and cancer: coming of age. Nat Rev Immunol 18(5): 309-324, 2018. DOI: 10.1038/nri.2017.142
    OpenUrlCrossRefPubMed
  56. ↵
    1. Zhang X,
    2. Song Y,
    3. Ci X,
    4. An N,
    5. Ju Y,
    6. Li H,
    7. Wang X,
    8. Han C,
    9. Cui J,
    10. Deng X
    : Ivermectin inhibits LPS-induced production of inflammatory cytokines and improves LPS-induced survival in mice. Inflamm Res 57(11): 524-529, 2008. DOI: 10.1007/s00011-008-8007-8
    OpenUrlCrossRefPubMed
    1. Yan S,
    2. Ci X,
    3. Chen N,
    4. Chen C,
    5. Li X,
    6. Chu X,
    7. Li J,
    8. Deng X
    : Anti-inflammatory effects of ivermectin in mouse model of allergic asthma. Inflamm Res 60(6): 589-596, 2011. DOI: 10.1007/s00011-011-0307-8
    OpenUrlCrossRefPubMed
  58. ↵
    1. Ventre E,
    2. Rozières A,
    3. Lenief V,
    4. Albert F,
    5. Rossio P,
    6. Laoubi L,
    7. Dombrowicz D,
    8. Staels B,
    9. Ulmann L,
    10. Julia V,
    11. Vial E,
    12. Jomard A,
    13. Hacini-Rachinel F,
    14. Nicolas JF,
    15. Vocanson M
    : Topical ivermectin improves allergic skin inflammation. Allergy 72(8): 1212-1221, 2017. DOI: 10.1111/all.13118
    OpenUrlCrossRefPubMed
  59. ↵
    1. Ozawa Y,
    2. Suda T,
    3. Naito T,
    4. Enomoto N,
    5. Hashimoto D,
    6. Fujisawa T,
    7. Nakamura Y,
    8. Inui N,
    9. Nakamura H,
    10. Chida K
    : Cumulative incidence of and predictive factors for lung cancer in IPF. Respirology 14(5): 723-728, 2009. DOI: 10.1111/j.1440-1843.2009.01547.x
    OpenUrlCrossRefPubMed
  60. ↵
    1. Fujimoto T,
    2. Okazaki T,
    3. Matsukura T,
    4. Hanawa T,
    5. Yamashita N,
    6. Nishimura K,
    7. Kuwabara M,
    8. Matsubara Y
    : Operation for lung cancer in patients with idiopathic pulmonary fibrosis: surgical contraindication? Ann Thorac Surg 76(5): 1674-1678, 2003. DOI: 10.1016/s0003-4975(03)00966-4
    OpenUrlCrossRefPubMed
    1. Minegishi Y,
    2. Kuribayashi H,
    3. Kitamura K,
    4. Mizutani H,
    5. Kosaihira S,
    6. Okano T,
    7. Seike M,
    8. Azuma A,
    9. Yoshimura A,
    10. Kudoh S,
    11. Gemma A
    : The feasibility study of carboplatin plus etoposide for advanced small cell lung cancer with idiopathic interstitial pneumonias. J Thorac Oncol 6(4): 801-807, 2011. DOI: 10.1097/JTO.0b013e3182103d3c
    OpenUrlCrossRefPubMed
    1. Tomassetti S,
    2. Gurioli C,
    3. Ryu JH,
    4. Decker PA,
    5. Ravaglia C,
    6. Tantalocco P,
    7. Buccioli M,
    8. Piciucchi S,
    9. Sverzellati N,
    10. Dubini A,
    11. Gavelli G,
    12. Chilosi M,
    13. Poletti V
    : The impact of lung cancer on survival of idiopathic pulmonary fibrosis. Chest 147(1): 157-164, 2015. DOI: 10.1378/chest.14-0359
    OpenUrlCrossRefPubMed
    1. Fukuizumi A,
    2. Minegishi Y,
    3. Omori M,
    4. Atsumi K,
    5. Takano N,
    6. Hisakane K,
    7. Takahashi S,
    8. Kobayashi K,
    9. Sugano T,
    10. Takeuchi S,
    11. Noro R,
    12. Seike M,
    13. Kubota K,
    14. Azuma A,
    15. Gemma A
    : Weekly paclitaxel in combination with carboplatin for advanced non-small-cell lung cancer complicated by idiopathic interstitial pneumonias: a single-arm phase II study. Int J Clin Oncol 24(12): 1543-1548, 2019. DOI: 10.1007/s10147-019-01516-9
    OpenUrlCrossRefPubMed
  64. ↵
    1. Minegishi Y,
    2. Gemma A,
    3. Homma S,
    4. Kishi K,
    5. Azuma A,
    6. Ogura T,
    7. Hamada N,
    8. Taniguchi H,
    9. Hattori N,
    10. Nishioka Y,
    11. Tanizawa K,
    12. Johkoh T,
    13. Yokoyama T,
    14. Mori K,
    15. Taguchi Y,
    16. Ebina M,
    17. Inase N,
    18. Hagiwara K,
    19. Ohnishi H,
    20. Mukae H,
    21. Inoue Y,
    22. Kuwano K,
    23. Chiba H,
    24. Ohta K,
    25. Tanino Y,
    26. Sakai F,
    27. Sugiyama Y
    : Acute exacerbation of idiopathic interstitial pneumonias related to chemotherapy for lung cancer: nationwide surveillance in Japan. ERJ Open Res 6(2): 00184-2019, 2020. DOI: 10.1183/23120541.00184-2019
    OpenUrlCrossRefPubMed
  65. ↵
    1. Ma Y,
    2. Xu X,
    3. Wu H,
    4. Li C,
    5. Zhong P,
    6. Liu Z,
    7. Ma C,
    8. Liu W,
    9. Wang C,
    10. Zhang Y,
    11. Wang J
    : Ivermectin contributes to attenuating the severity of acute lung injury in mice. Biomed Pharmacother 155: 113706, 2022. DOI: 10.1016/j.biopha.2022.113706
    OpenUrlCrossRefPubMed
    1. Abd-Elmawla MA,
    2. Ghaiad HR,
    3. Gad ES,
    4. Ahmed KA,
    5. Abdelmonem M
    : Suppression of NLRP3 inflammasome by ivermectin ameliorates bleomycin-induced pulmonary fibrosis. J Zhejiang Univ Sci B 24(8): 723-733, 2023. DOI: 10.1631/jzus.B2200385
    OpenUrlCrossRefPubMed
  67. ↵
    1. Mohammed SW,
    2. El-Megrab NA,
    3. Hasan AA,
    4. Gomaa E
    : A remodeled ivermectin polycaprolactone-based nanoparticles for inhalation as a promising treatment of pulmonary inflammatory diseases. Eur J Pharm Sci 195: 106714, 2024. DOI: 10.1016/j.ejps.2024.106714
    OpenUrlCrossRefPubMed
Back to top

In this issue

Print
Download PDF
Article Alerts
Email Article
Citation Tools
Reprints and Permissions
Ivermectin Enhances Paclitaxel Efficacy by Overcoming Resistance Through Modulation of ABCB1 in Non-small Cell Lung Cancer
ANNA HAYASHI, KOICHIRO KAMIO, AKIHIKO MIYANAGA, KEISUKE YOSHIDA, RINTARO NORO, KUNIKO MATSUDA, TAKEHIRO TOZUKA, MIWAKO OMORI, MARIKO HIRAO, AYA FUKUIZUMI, KAKERU HISAKANE, SUSUMU TAKEUCHI, MASARU MATSUMOTO, KAZUO KASAHARA, TAKANORI AMANO, KAZUFUMI HONDA, MASAHIRO SEIKE
Anticancer Research Dec 2024, 44 (12) 5271-5282; DOI: 10.21873/anticanres.17355
Twitter logo Facebook logo Mendeley logo

Jump to section

Keywords