Abstract
Background/Aim: It is not possible to differentiate prostate carcinomas sufficiently to ensure that every patient receives the right therapy. New molecular markers are needed. Our objective was to identify a complex consisting of vimentin variant 3 (VIM3), autophagy-related protein 7 (ATG7) and tumor protein p53 (TP53) in prostate cancer cells and its effect on microRNA (miR)-371a-3p. Materials and Methods: Prostate cancer cell lines (PC3, DU145, LNCaP) and the benign prostatic hyperplasia cell line BPH-1 were cultured in growth medium for 24 h, then stimulated with endothelin 1 (EDN1) (50 nM) and withaferin A (2 nM) for 24 h. Cell extracts were then analyzed by western blot. The localization of VIM3, ATG7 and TP53 in the nucleus was demonstrated with immunofluorescence staining and complex formation was demonstrated by immunoprecipitation. Cancer cell migration was analyzed with a scratch assay and agarose drop analysis. The binding of the complex to the promoter of pri-miR-371a-3p was analyzed with a non-radioactive electrophoretic mobility shift assay. VIM3 knockdown using small interfering RNA and quantitative real-time polymerase chain reaction for miR-371a-3p were performed. Results: The complex was present in the nucleus of prostate cancer cells and in the BPH-1 cell line. EDN1 increased the levels of the complex partners and cell migration, whereas withaferin A reduced the levels of the complex partners and migration. The complex bound to the promoter of pri-miR-371a-3p and might be involved in its transcription. Transfection with miR-371a-3p increased migration of prostate cancer cells. VIM3 knockdown reduced miR-371a-3p expression. Conclusion: The VIM3–ATG7–P53 complex, with its stimulatory effect on miR-371a-3p, may have the potential to be a marker for improved differentiation between prostate carcinomas, allowing tailored therapy.
Prostate cancer is one of the most common neoplasias in men and is the fifth most lethal cancer in males worldwide (1, 2). Especially in Western countries, a decrease in mortality was observed in recent years, which is probably a result of the improvement in screening measures (3). Improvements in diagnosis and therapy, as well as a progressively aging population has resulted in a progressively increasing incidence. The combination of the reduced mortality and increasing incidence has made prostate cancer a major health problem (1, 4). This underlines the need for further improvement in diagnostic techniques and therapeutic options.
The detection of prostate cancer is based on the prostate-specific antigen level and magnetic resonance imagining, followed by a magnetic resonance imaging fusion prostate biopsy (5, 6). The individual risk classification is determined by the prostate-specific antigen level, tumor volume and the Gleason Score (7). However, prostate cancer is known for its extreme tumor heterogeneity at the genetic as well as the cell biology level (8). Currently, the genetic and biological characteristics, and therefore the level of tumor aggressiveness, cannot be sufficiently determined (8).
It is still not possible to differentiate prostate carcinomas to an extent to which every patient receives reliable information on their prognosis and exactly the therapy that is needed. This applies especially to carcinomas with Gleason Score 7, which have very different prognoses and recurrence rates (9). There are several carcinomas which are classified as intermediate risk but are in fact high risk and which therefore do not receive the necessary therapy (7).
Recently, vimentin variant 3 (VIM3; PubMed: ACA06103.1) was discovered as a potential surrogate marker for prostate cancer (10). VIM3 is related to vimentin, an intermediate filament in mesenchymal and muscle cells, but with the important difference that it lacks the C-terminal ending of full-length vimentin (VIM-FL) (11). Due to a lack of specific antibodies, for a long time, it was not possible to differentiate between VIM-FL and VIM3. However, our research group was able to design an antibody which specifically binds to the unique C-terminal ending of VIM3 (12).
Our research group recently analyzed the effects of endothelin 1 (EDN1) on the expression of VIM3 (13). EDN1 was first described in 1988 as a vasoconstrictor peptide and is currently known as a multifunctional protein in cancer (14). Since it is known that elevated EDN1 levels in patients with prostate cancer are associated with higher metastatic potential and that the levels of EDN1 in cancer cells correlate with tumor progression, we were interested whether elevated EDN1 levels also correlate with higher VIM3 levels (15, 16). In previous work, we showed that prostate cancer cells migrated faster under stimulation with EDN1 and that EDN1 induced VIM3 expression (13).
Since we hypothesized that VIM3 might be a potential marker of prostate cancer malignancy and that higher expression of VIM3 might result in worse outcomes, we were interested in how VIM3 expression might be reduced. It is already known that treatment with withaferin A (WA) leads to down-regulation of VIM-FL. However, the exact site of interaction is unknown (17). WA is derived from the root of Withania somnifera and is used in different traditional medicine systems. In 1992, WA was used in cancer treatment of an in vivo cancer model for the first time (18). It has been shown that WA reduces growth of new tumor cells (19). We assume that it is also possible that VIM3 is a target of WA.
It has also been demonstrated that vimentin has a binding side for tumor protein p53 (TP53), a well-known tumor-suppressor, and that they form a complex (20). However, immunoprecipitation showed an additional band at 47 kDa, which correlates to the size of VIM3 and not VIM-FL.
Another well-known interaction partner of TP53 is autophagy-related 7 protein (ATG7) (21). It is known that autophagy plays a major role in carcinogenesis. Literature reports the formation of a complex between TP53 and ATG7 and shows that high expression of TP53 and ATG7 goes hand in hand with a poor prognosis (22).
We hypothesized that VIM3, TP53 and ATG7 create a complex which migrates into the nucleus and regulates the transcription of different proteins. The different results in literature concerning vimentin raise the question whether VIM3 is necessary for the formation of a such a complex.
As a potential target gene for our hypothesized complex, we focused on the microRNA miR-371a-3p. miRNAs are small noncoding RNAs which are often dysregulated in cancer cells (23). Up-regulation of miR-371a-3p was found in association with a lower expression of phosphatase and tensin homolog (PTEN), which is frequently lost in prostate cancer (24, 25).
The importance of improving the risk classification of prostate cancer lies in the fact that therapy options are broad. There are carcinomas which can be stable for several years, whereas others show rapid progression and a high recurrence rate after treatment. To avoid unnecessary therapy, it is therefore of extreme importance to improve diagnostic differentiation in this very heterogeneous group of cancer types.
Our aim was the identification of a complex consisting of VIM3, ATG7 and TP53 in the nucleus of prostate cancer cell lines. We wanted to show that the complex is significantly overexpressed in prostate cancer cells and might potentially work as a marker for improved differentiation of prostate carcinomas in the future. Furthermore, we analyzed whether the expression of the complex correlated with the expression of miR-371a-3p and whether knockdown of VIM3 might be used as a potential new therapy target.
Materials and Methods
Cell culture and treatment. The prostate cancer cell lines PC3 (ATCC: CRL-1435), LNCaP (ATCC: CRL-1740) and DU145 (ATCC: HTB-81) were obtained from the American Type Culture Collection (Manassas, VA, USA) and tested negative for mycoplasma contamination. The benign prostatic hyperplasia cell line BPH-1 (ACC 143) was obtained from DSMZ-German Collection of Microorganisms and Cell Cultures GmbH (Braunschweig, Germany).
PC3 and LNCaP cells were cultured in Roswell Park Memorial Institute Medium (Life Technology GmbH, Darmstadt, Germany) supplemented with 10% fetal bovine serum (FBS; PAN-Biotech GmbH, Aidenbach, Germany) and 1% penicillin/streptomycin (Invitrogen, Karlsruhe, Germany). DU145 cells were cultured in Dulbecco’s modified Eagle’s medium (Life Technology GmbH), supplemented with 10% FBS and 1% penicillin/streptomycin and BPH-1 cells were cultured in RMPI medium, supplemented with 20% FBS and 1% penicillin/streptomycin. The cells were cultivated in 100 mm cell culture dishes and 10 ml of the respective medium. The cells were cultured at 37°C with 5% CO2. For cell stimulation, the cells were cultivated in 35 mm cell culture dishes and 2 ml medium. After 24 h, a confluency of around 70% was reached. After serum starvation for 24 h, cells were treated with 50 nM EDN1 (Sigma, Deisenhofen, Germany) alone and in combination with 2 nM WA (Sigma) for another 24 h.
Immunofluorescence staining. For demonstration of the complex partners in the nucleus, cells were seeded at a confluency of 70% in Lab-Teks (Thermo Fisher Scientific, Inc., Waltham, MA, USA) in 400 μl medium/well. After 24 h, the cells were washed and frozen with acetone-methanol. After applying primary antibody ATG7 (B-9) mouse monoclonal IgG/p53 (A-1) mouse monoclonal IgG/vimentin (V9) mouse monoclonal IgG1 (Santa Cruz Biotechnology, Heidelberg, Germany) or VIM3 (clone 52; Davids Biolab, Regensburg, Germany) at 1:500 dilution for all, the cells were incubated in the dark for 1 h. After a phosphate-buffered saline (PBS) (PAN-Biotech GmbH, Aidenbach, Germany) washing step, Alexa Fluor 488-conjugated goat anti-mouse IgG (Thermo Fisher Scientific, Inc., Waltham, MA, USA), or phycoerythrin-conjugated A11001/mouse-IgGK (Sc-516141, dilution 1:500; Santa Cruz Biotechnology) was applied. The localization of the complex partners was analyzed after applying 4′,6-diamidino-2-phenylindole (Thermo Scientific, Schwerte, Germany) to visualize the nucleus.
Immunoprecipitation. Immunoprecipitation was performed according to the protocol (Santa Cruz Biotechnology) using 500 μg total cellular protein. The final washing step was performed with PBS and the samples were diluted 1:5 in 20 μl electrophoresis sample buffer (Bio Rad, Munich, Germany). After a boiling step of 5 min, the samples were centrifuged and used for western blot analysis.
Western blot. In a previous step, total protein was extracted using RIPA (Radioimmunoprecipitation assay) lysis buffer (Qiagen GmbH, Hilden, Germany) and the protein concentration was determined according to the protocol of a Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, Inc., Waltham, MA, USA). Proteins (25 μg) were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then transferred to a nitrocellulose membrane. Then the membranes were blocked in 3% Tris-buffered saline–Tween 20 milk for 1 h. After that, membranes were incubated with ATG7 (B-9) mouse monoclonal IgG/p53 (A-1) mouse monoclonal IgG/vimentin (V9) mouse monoclonal IgG1 (Santa Cruz Biotechnology) or VIM3 clone 52 (Davids Biolab) at 1:500 dilution for 1 h. Finally, horseradish peroxidase-conjugated goat anti-mouse IgG secondary antibody (Biomol GmbH, Hamburg, Germany) was employed at a dilution of 1:5,000 for 1 h or overnight. INTAS Chemostar (Intas Science Imaging, Göttingen, Germany) was used to analyze the blots.
Scratch assay. The cell lines were grown in 100 mm tissue culture dishes until they reached a confluency of 80-90%. Cells were serum-starved for 24 h, and a scratch was manually added in the middle of the cell culture plate with a pipette tip. The cells were treated with 50 nM EDN1 and 2 nM WA or a combination of both. The migration of prostate cancer cells was documented after 0, 3, 6 and 24 h.
DNA pull down with VIM3. For the DNA pull down with VIM3, DNA was obtained from the prostate cancer cell lines (PC3, LNCaP, DU145) and the BPH-1 cell line using a QIAamp DNA mini kit (Qiagen GmbH). VIM3 antibody (VIM3 clone 52; Davids Biolab) was coupled with agarose beads (1:10) (Santa Cruz Biotechnology) and the pull down was performed on ice for 1 h. For the visualization of the PCR product of the promoter region of pri-miR-371a-3p, a 12% polyacrylamide gel was used at 100 V for 40 min.
Non-radioactive electrophoresis mobility shift assay (EMSA). To detect the interaction between VIM3 and the promoter region of pri-miR-371a-3p, an EMSA was performed. Nuclear extracts were isolated from PC3, LNCaP, DU145 and BPH-1 cells (Nuclear Extraction Kit; Active Motif, Waterloo, Belgium) which were previously treated with 50 nM EDN1 with and without 2 nM WA, or which received no treatment according to the protocol (Thermo Fisher Scientific, Inc., Waltham, MA, USA). The treatment was performed as described above. Bradford protein assay with bovine serum albumin (Thermo Fisher Scientific Inc., Rockford, IL, USA) as standard was performed to determine the protein content. Palindromic oligonucleotides were designed in a way that they bound the hypothesized promoter region of the pri-miR-371a-3p (Eurofins Genomics, Ebersberg, Germany). Twenty micrograms of nuclear protein extracts of prostate cancer cells (PC3, LNCaP, DU145) and BPH-1 cells were incubated for the supershift with 5 μl of VIM3 antibody (VIM3 clone 52; Davids Biolab), followed by incubation with Cy5-labeled oligonucleotides specific for the hypothetical promoter region of pri-miR-371a-3p. An 8% non-denaturing polyacrylamide gel was run for 120 min at 80 V to visualize the results. The methodology was previously described in detail by Gerstung et al. (26).
EMSA probes used were pri-miRNA 371a VIM3: Cy5-labeled TAGCTGGGACTACAGGCTTGACCACTCCGCCCAGC; unlabeled TAGCTGGGACTACAGGCTTGACCACTCCGCCAGC; and reverse: GCTGGGCGGAGTGGCTCAAGCCTGTAGTCCC AGCTA
Agarose drop assay. Agarose powder (0.2 g) was mixed with 5 ml PBS and microwaved for 15 to 30 s at 800 W. Cells from each cell line (PC3, DU145, LNCaP, BPH-1) were harvested from four 100 mm cell culture dishes and resuspended in just as much medium as needed to cover the cell pellet. Afterwards 30 μl of lukewarm agarose were added. Then 5 μl of the agarose-cell mix was added to a 24-well plate. The plate was maintained at 4°C for 15 min to fix the agarose drop. Afterwards, the cells in the agarose drops were transfected with 10 μM miR-371a-3p in 200 μl medium per well. Images were taken after 0, 24, 48 and 72 h to analyze the migration of cancer cells.
siRNA. For VIM3 knockdown, cells from each cell line were cultivated in 6-well plates until they reached a confluency of around 70%. Then lipofectamine reagent (Invitrogen Corp., Karlsruhe, Germany) was mixed with the respective medium of each cell line (PC3, LNCaP, DU145, BPH-1) and followed by an incubation for for 5 min at room temperature (dilution 1:50). In the next step, VIM3 siRNA or negative siRNA (Invitrogen Corp.) was added, followed by an incubation of 20 min; 500 μl of that mixture were added to one well in a 6-well plate for each cell line. This was followed by a final incubation of 72 h. After this incubation period, miRNA was isolated as described below. For combined stimulation with siRNA and EDN1, cells were pretreated for 48 h with the siRNA and then 50 nM EDN1 was added for another 24 h.
miRNA extraction from cell cultures and DNA synthesis. PC3, LNCaP, DU145 and BPH-1 cells were either treated with siRNA control, 50 nM EDN1, VIM3 siRNA or VIM3 siRNA and EDN1 in combination. miRNA was extracted using miRNeasy Kit according to the manufacturer’s protocol (Qiagen GmbH). The total amount of RNA was determined via NanoDrop technology (Thermo Fisher Scientific, Inc., Waltham, MA, USA) (27). For cDNA synthesis, 100 ng total RNA was used. Reverse transcription of the 100 ng RNA was performed according to the manufacturer’s protocol using the miScript Kit (Qiagen GmbH). The converted cDNA was either stored at −20°C for later analysis or used directly for quantitative real-time polymerase chain reaction.
Quantitative real-time polymerase chain reaction (PCR). For the PCR, twin.tec 96- well PCR plates (Eppendorf, Hamburg, Germany) were used. The master mix contained 10 μl SYBR green (Thermo Fisher Scientific, Inc., Waltham, MA, USA), 0.4 μl MytiCq primer (MERCK, Darmstadt, Germany), 1 μl primer and 8.6 μl RNAse-free water per sample; 19 μl mastermix was added to 1 μl cDNA sample. For quantification, the 2−ΔΔCT method was used (28).
StatisticaI analysis. All experiments were performed in triplicates. The statistical analysis was performed with GraphPrism 9 (Graphpad software, La Jolla, CA, USA). The western blots were analyzed with Image J (National Institutes of Health, Bethesda, MD, USA).
Results
Presence of ATG7, VIM3 and TP53 in prostate cancer cells and complex formation. The presence of the hypothesized complex partners in prostate cancer cells was demonstrated with western blotting. Figure 1A shows that all complex partners were expressed in prostate cancer cells. The expression of VIM3, TP53 and ATG7 was significantly higher in prostate cancer cells (PC3, LNCaP, DU145) than in BPH-1 cells (Figure 1B). Immunoprecipitation of all combinations showed that ATG7, TP53 and VIM3 exist as a complex in prostate cancer cells as well as BPH-1 cells (Figure 1C). Since we wanted to show that the complex might work as a potential transcription factor for different proteins, we needed to determine whether the complex was present in the nucleus. Figure 1D shows that all complex partners were present in the nucleus. In particular, the VIM3 content appears to be higher than that of VIM-FL.
Demonstration of the presence of vimentin variant 3 (VIM3), autophagy-related protein 7 (ATG7) and tumor protein p53 (TP53) as a complex in prostate cancer cells. A: Western blot visualization with specific antibodies for VIM3, ATG7, TP53 and full-length vimentin (VIM-FL) in LNCaP, PC3 and DU145 prostate cancer cells and the benign prostatic hyperplasia cell line BPH-1. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a reference control. B: Graphical illustration of the relative protein concentration of VIM3, TP53, VIM-FL and ATG7. The expression was measured relative to GAPDH which was set to 100%. Data are means with the respective standard deviation based on three independent experiments. Significantly different from BPH-1 cells at: *p<0.05, **p<0.01 and ***p<0.001 C: Immunoprecipitation (IP) for all potential combinations for PC3 cells. For IP, the first protein is that for which the specific antibody was coupled to agarose beads beforehand, and the second protein is that analyzed via Western blot using the specific antibody as previously described. D: Presentation of the localization of VIM3, ATG7, TP53 and VIM-FL in the nucleus of LNCaP, PC3 and DU145 cells using immunofluorescence, with direct comparison of the localization of VIM3 and VIM-FL in the latter.
Treatment with EDN1 and WA. The prostate cancer cell lines (PC3, DU145 and LNCaP) were treated with EDN1 and WA, alone and in combination. Treatment with EDN1 led to a significant increase in the protein concentration of VIM3, VIM-FL and ATG7, while it slightly reduced the expression of TP53. Treatment with WA led to a significant reduction in the protein concentration of VIM3 and ATG7. The expression of TP53 was up-regulated by WA (Figure 2A and B).
A: Western blot of 25 μg total protein of untreated LNCaP cells and LNCaP cells that were treated with 50 nM endothelin 1 (EDN1) with/without 2 nM withaferin A (WA) for 24 h. Specific antibodies for autophagy-related protein 7 (ATG7), tumor protein p53 (TP53), vimentin full-length (VIM-FL) and vimentin variant 3 (VIM3) were used. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a reference control. B: Analysis of band intensities in western blots with ImageJ. The amounts of VIM3, VIM-FL, TP53 and ATG7 were calculated relative to that of GAPDH. Data are means with the respective standard deviation based on three independent experiments. Significantly different from untreated control cells at: *p<0.05, **p<0.01 and ***p<0.001. C: Scratch assay of DU145 cells which received no treatment and cells which were treated with 50 nM EDN1 with/without 2 nM WA. The graph shows the migration of prostate cancer cells over a 24-h period by microscopy. D: Quantification of migration based on manual counting of the migrated cells. Data are means with the respective standard deviation based on three independent experiments. At 24 h, the number of migrated cells was compared between treated and untreated control cells. ***Significantly different from the control at p<0.001.
The scratch assay showed that cells that were treated with EDN1 migrated significantly faster than those without treatment according to the count of cells which migrated into the scratch (Figure 2C and D). Stimulation with WA reduced cell migration significantly.
VIM3 as a transcription factor of miR-371a-3p. To show the interaction between the hypothesized promoter region of pri-miR-371a-3p and the newly identified complex, PCR followed by 12% polyacrylamide gel electrophoresis was performed. A VIM3 DNA pulldown was performed as previously described and a primer for the hypothesized promotor region of pri-miR-371a-3p was used. As control, untreated DNA from the different cell lines (PC3, LNCaP, DU145, BPH-1) were used. For all used cell lines, signals for the VIM3 pull down DNA and the untreated DNA were detected (Figure 3A).
A: DNA pull down: Visualization of the polymerase chain reaction (PCR) product for pri-miRNA (miR)-371a-3p. DNA was isolated from prostate cancer cells (PC3, LNCaP, DU145) and benign prostatic hyperplasia cell line BPH-1. Vimentin variant 3 (VIM3) pull down indicates that the DNA was coupled to VIM3 with agarose beads (1:10) and only DNA bound to VIM3 was analyzed. Control refers to untreated DNA which was not coupled to VIM3. For the visualization of the PCR product of pri-miR-371a-3p, a 12% polyacrylamide gel was run at 100 V for 40 min. B: Non-radioactive electrophoresis mobility shift assay of pri-miR-371a-3p promoter region of the prostate cancer and BPH-1 cell lines. Nuclear extracts were isolated from all cell lines which were previously treated with 50 nM endothelin 1 (EDN1) or which received no treatment (control). EDN1-treated cells were used next to untreated control cells since it is known that EDN1 induces overexpression of VIM3 (13, 43). Nuclear extracts (20 μg) of the cells were incubated VIM3 antibody for the supershift, followed by an incubation with the specific palindromic oligonucleotides for the hypothesized promoter region of pri-miR-371a-3p. An 8% non-denaturing polyacrylamide gel was run for 120 min at 80 V to visualize the results. C: Agarose drop analysis of DU145 cells. The agarose drop assay was performed for all cell lines. Untreated cells were compared with cells that were transfected with miR-371a-3p (10 μM). Images were taken with a microscope after 0, 24, 48 and 72 h. D: Quantitative real-time PCR results after siRNA knockdown of VIM3 in cell lines. Cells were either treated with VIM3 siRNA for 72 h or with siRNA and then 50 nM EDN1 for another 24 h. siRNA control functioned as an internal control to show that the siRNA background had no influence on the expression of the miR-371a-3p. EDN1 treatment was used as a positive control since it is known that EDN1 leads to up-regulation of VIM3, therefore higher expression of miR-371a-3p would be expected (43). After the final incubation, miR-371a-3p was extracted and reverse transcription of 100 ng RNA was performed. PCR was performed and the 2−ΔΔCT method was used for quantification (28). All differences were significant (p<0.0001).
To show the significance of VIM3 for the promotor region of the pri-miR-371a-3p and the involvement of the complex as a potential transcription factor for the pri-miR-371a-3p, a non-radioactive EMSA was performed. The supershift indicates the binding of VIM3 to the promotor region of the pri-miR-371a-3p (Figure 3B).
We then analyzed the effect of a transfection with the miR-371a-3p on prostate cancer cells via agarose drop analysis. After 24 h no significant difference could be observed in the number of migrated cells between control cells and cells that were transfected with the miR-371a-3p. After 48 and 72 h the number of migrated cells is higher for the cells that were transfected with miR-371a-3p compared to the control cells. The effect was strongest for PC3 and DU145 cells. The results for DU145 cells are shown in Figure 3C.
VIM3 knockdown and expression of miR-371a-3p. It is known that up-regulation of miR-371a-3p results in a lower expression of PTEN, and PTEN expression is frequently lost in prostate cancer (29, 30). We were interested in whether VIM3 knockdown would reduce expression of miR-371a-3p in prostate cancer cell lines, consequently leading to increased PTEN expression. Quantitative PCR of miR-371a-3p was performed. As demonstrated in Figure 3D, the expression of miR-371a-3p was significantly lower in cells with VIM3 siRNA knockdown compared to cells treated with EDN1. For BPH-1 and PC3 cells, the expression of miR-371a-3p was also significantly lower in VIM3 siRNA knockdown cells compared to cells that were treated with siRNA and EDN1 in combination. In comparison with the siRNA control cells, a slight increase in miR-371a-3p expression was observed after VIM3 siRNA knockdown for all cell lines.
Discussion
The results presented here indicate that VIM3, TP53 and ATG7 build a complex in prostate cancer cells, which migrates into the nucleus and appears to act as a transcription factor complex for miR-371a-3p. The expression of the complex and the migration of prostate cancer cells is influenced by treatment with EDN1 and WA.
All hypothesized complex partners were found to be present in the prostate cancer cells. VIM3 and TP53 expression was highest in PC3 cells. TP53 is known to be overexpressed in prostate cancer and knockdown of TP53 results in a slower migration of prostate cancer cells (31). Our research group also showed that VIM3 protein levels increased significantly with increasing biological aggressiveness of human prostate cancer specimens from prostate biopsies/radical prostatectomy specimens (10). Therefore, the high VIM3 and TP53 expression in PC3 cells agrees with the literature since the PC3 cell line is described as being more aggressive (32).
The formation of the VIM3–ATG7–TP53 complex was confirmed via immunoprecipitation. The complex was present in all prostate cancer cell lines (PC3, LNCaP, DU145) as well as the BPH cell line BPH-1. Although we hypothesize that the complex might be useful as a malignancy marker, its presence in BPH-1 cells is not surprising since immunoprecipitation is a semi-quantitative method.
Immunofluorescence confirmed that the complex is located in the nucleus of prostate cancer cells (PC3, LNCaP, DU145). Comparison showed that VIM3 expression was higher than VIM-FL expression in the nucleus. As recently described, the expression of VIM3 seems to be of great importance for prostate cancer cells (13). Carcinoma cells which are more aggressive have higher levels of VIM3 (10). This observation is explained by the fact that vimentin is associated with a higher malignancy of cancer cells and is more highly expressed in poorly differentiated prostate cancer (33). Therefore, VIM3 might also be an important factor for metastatic behavior of prostate cancer cells.
Regarding treatment of the cells with EDN1/WA, the results in this study are consistent with the existing information in the literature. Treatment with EDN1 leads to a higher migration rate of cancer cells and a higher protein expression of VIM3 and ATG7. As previously described by our research group, EDN1 leads to down-regulation of TP53 (15, 34). WA is also known to slow tumor cell growth (18). Nevertheless, the effects on prostate cancer have not been sufficiently evaluated. This study showed that treatment with WA significantly reduced migration of prostate cancer cells and lowered expression of VIM3 and ATG7. Several studies using different cell lines and animal models have been performed in the past to evaluate the mechanisms and therapeutic potential of WA (35). It has been shown that WA acts as an anticancer agent through different major mechanisms. One of them is the induction of TP53 accumulation (36). Others are the down-regulation of human papillomavirus E6 and E7 oncoprotein expression (37) and cell-cycle arrest at G2/M phase, which is associated with modification of cyclin B1, p34, CD2 and activation of proteasomal enzymes (36, 38, 39). In lung cancer cells, treatment with WA resulted in the induction of apoptosis via up-regulation of pro apoptotic molecules such as TP53 and BCL2-associated X, apoptosis regulator (40). WA as an affordable, natural product might be a great addition to the therapy of prostate cancer in the future. While it was already known that WA has an impact on VIM-FL, we showed that VIM3 expression is also affected by WA (Figure 2A).
Since the complex was found in the nucleus, we were interested whether it functions as part of a transcription factor for other target genes. We examined whether there was a connection between the identified complex and miR-371a-3p. We found the newly identified complex bound to the promotor region of pri-miR-371a-3p and therefore appears to have a direct stimulatory effect on the transcription of miR-371a-3p (Figure 3A and B). Alhasan et al. reported that miR-371a-3p expression was increased in aggressive prostate cancer (29). Furthermore, overexpression of miR-371a-3p also led to down-regulation of the tumor-suppressor PTEN (29). PTEN loss is among the most common genomic aberrations in prostate cancer and results in activation of the phosphatidylinositol-4,5-bisphosphate 3-kinase-AKT serine/threonine kinase 1 pathway and is strongly correlated with adverse oncological outcomes (30).
We hypothesized that VIM3 is part of the complex formed with ATG7 and TP53 and that this complex positively influences the expression of miR-371a-3p. Therefore, we were interested whether VIM3 knockdown led to a lower expression of miR-371a-3p. The knockdown of VIM3 led to down-regulation of miR-371a-3p compared to cells treated with EDN1 for all prostate cancer cell lines (Figure 3D). The high expression of miR-371a-3p after EDN1 treatment can be explained by the fact that EDN1 induces VIM3 expression, which results in higher miR-371a-3p expression (13). However, a slight increase of miR-371a-3p expression was observed after VIM3 siRNA treatment compared to the siRNA control cells. This can be explained by the fact that the transfection of the cells with siRNA has a potentially stimulatory effect on the expression of miR-371a-3p since artificial products were added. Because we performed knockdown and not knockout, it cannot be guaranteed that VIM3 is fully eliminated, which might explain the slight increase in miR-371a-3p expression in general (41). In further experiments, the results should be confirmed using knockout of VIM3. If knockout of VIM3 led to lower miR-371a-3p expression, it might result in a higher expression of the tumor-suppressor gene PTEN. Since PTEN plays an essential role in the carcinogenesis of prostate cancer, VIM3 might become an excellent target for new therapeutic strategies (42).
Conclusion
VIM3, ATG7 and TP53 are significantly overexpressed in prostate cancer cell lines.
A novel connection between the complex consisting of VIM3, ATG7 und TP53 and miR-371a-3p was demonstrated. The complex appears to affect transcription of miR-371a-3p. Transfection with miR-371a-3p increased prostate cancer cell migration.
Since knockdown of VIM3 led to lower expression of miR-371a-3p compared to EDN1-treated cells and therefore presumably a higher level of PTEN, the VIM3-containing complex might act as a novel marker to better differentiate heterogeneous prostate carcinomas and should be further analyzed in patient blood and tissue samples as an interesting target for new therapies.
Acknowledgements
Elena K. Nohl was supported by the Koeln Fortune Program/Faculty of Medicine, University of Cologne (861€/month for 1 year).
Footnotes
Authors’ Contributions
Conception and design: Axel Heidenreich and Melanie von Brandenstein. Administrative support: Axel Heidenreich and Melanie von Brandenstein. Provision of study materials or patients: Elena K. Nohl, Axel Heidenreich, Melanie von Brandenstein and Barbara Köditz. Collection and assembly of data: Elena K. Nohl and Jasmin Behring. Data analysis and interpretation: Elena K. Nohl and Melanie von Brandenstein. Article writing: All Authors. Final approval of article: All Authors
Conflicts of Interest
All Authors have completed the ICMJE uniform disclosure form. All Authors have no conflicts of interest to declare.
- Received March 16, 2023.
- Revision received March 31, 2023.
- Accepted April 5, 2023.
- Copyright © 2023 International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY-NC-ND) 4.0 international license (https://creativecommons.org/licenses/by-nc-nd/4.0).
References
In this issue
Jump to section
Related Articles
Cited By...
- No citing articles found.