Research ArticleExperimental Studies

Administration of Gapmer-type Antisense Oligonucleotides Targeting γ-Glutamylcyclotransferase Suppresses the Growth of A549 Lung Cancer Xenografts

HIROMI II, YUUYA KASAHARA, HARUMI YAMAGUMA, SUSUMU KAGEYAMA, AKIHIRO KAWAUCHI, SATOSHI OBIKA and SUSUMU NAKATA
Anticancer Research March 2022, 42 (3) 1221-1227; DOI: https://doi.org/10.21873/anticanres.15589

Abstract

Background/Aim: γ-Glutamyl cyclotransferase (GGCT) is up-regulated in various cancer types, including lung cancer. In this study, we evaluated efficacy of gapmer-type antisense oligonucleotides (ASOs) targeting GGCT in an A549 lung cancer xenograft mouse model and studied their mechanisms of action. Materials and Methods: GGCT was inhibited using GGCT-ASOs and cell proliferation was evaluated by dye exclusion test. Western blot analysis was conducted to measure expression of GGCT, p21, p16 and p27, phosphorylation of AMP-activated protein kinase, and caspase activation in A549 cells. Induction of apoptosis and up-regulation of reactive oxygen species were assessed by flow cytometry using annexin V staining and 2’,7’-dichlorodihydrofluorescein diacetate dye, respectively. Results: GGCT-ASOs suppressed GGCT expression in A549 cells, inhibited proliferation, and induced apoptosis with activation of caspases. GGCT-ASOs also increased expression of cell-cycle regulating proteins, phospho-AMPK and ROS levels. Systemic administration of GGCT-ASOs to animals bearing A549 lung cancer xenografts showed significant antitumor effects without evident toxicity. Conclusion: GGCT-ASOs appear to be promising as novel cancer therapeutic agents.

Key Words:

Lung cancer is the leading cause of cancer death worldwide. Within an estimated 2.2 million new cancer cases worldwide in 2020, lung cancer was the second most commonly diagnosed cancer (11.4%) and the leading cause of cancer death (1). Non-small-cell lung cancer (NSCLC) is the most common type of lung cancer; it is generally diagnosed at advanced stages, and patients have limited chemotherapy choices (2). Thus, novel treatments for patients with NSCLC are urgently needed.

γ-Glutamyl cyclotransferase (GGCT) was identified by proteomic analysis as C7orf24, and was shown to be highly expressed in bladder cancer (3). Board et al. reported that GGCT is an enzyme involved in the γ-glutamyl cycle for metabolizing the antioxidant glutathione (4). Further study showed GGCT to be up-regulated in various cancer types, including lung cancer (5). Interestingly, GGCT is one of the most significantly up-regulated genes in human lung adenocarcinoma compared with normal lung tissues. Recently, it was shown that patients with an increased GGCT copy number variation had a significantly lower overall survival rate from human lung adenocarcinoma (6). Oncogenic RAS signal up-regulated GGCT expression, and deletion of GGCT blocked RAS-mediated carcinogenesis in murine lung (6), suggesting that GGCT is a promising therapeutic target in lung cancer.

In a previous study, we revealed several mechanisms underlying the antiproliferative effects mediated by GGCT depletion. GGCT depletion inhibits cancer cell growth by inducing autophagy, followed by up-regulation of cyclin-dependent kinase inhibitors, including p21 and p16, and induction of cellular senescence (7).

RNA interference technology has been used to develop molecularly targeted therapies; however, without a drug delivery system, siRNAs are easily degraded. Therefore, antisense oligonucleotides (ASOs) containing phosphorothioate moieties have been developed and used in vitro and in vivo for this purpose (8). Recent studies demonstrated the in vivo stability and efficacy of ASOs containing amido-bridged nucleic acids (9-11).

In this study, employing gapmer-type ASOs that have improved stability, we explored the anticancer activity of GGCT-ASOs.

Materials and Methods

Synthesis of GGCT-ASOs. Phosphorothioate ASOs containing amido-bridged nucleic acid monomers (Table I) were synthesized and purified by Ajinomoto Bio-Pharma Services, using an automated DNA synthesizer (Osaka, Japan).

View this table:
Table I.

Sequences of antisense oligonucleotides used in this study.

Cell culture. A549 cells (American Type Culture Collection, Rockville, MD, USA) were maintained in Dulbecco’s modified Eagle’s medium (Wako Pure Chemical Industries, Osaka, Japan), supplemented with 10% fetal bovine serum and 1% penicillin–streptomycin solution (Wako) at 37°C in humidified air containing 5% CO2.

ASOs transfection. A549 cells were transfected with NEG-ASO-1 or GGCT-ASOs at a final concentration of 25-100 nM using Lipofectamine RNAi MAX (Invitrogen, Waltham, MA, USA). The sequences of the ASOs are given in Table I. Cells were collected and analyzed 72 h after transfection.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR). A549 cells transfected with non-targeting control ASO (NEG-ASO) or GGCT-ASOs were incubated with 9 mM CaCl2 (known as the Ca2+ enrichment of medium method) for 24 h (12). cDNA synthesis was performed using SuperPrep cell lysis and the RT kit for qPCR reagents (TOYOBO, Osaka, Japan). qPCR analysis was performed with SYBR green master mix (Thermo Fisher Scientific Waltham, MA, USA) using StepOnePlus (Thermo Fisher Scientific). GGCT gene-expression levels were normalized to those of the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Specific primers were purchased from Invitrogen (Thermo Fisher Scientific) as follows: Human GAPDH: GAGTCAACGGA TTTGGTCGT (sense), GACAAGCTTCCCGTTCTCAG (antisense); human GGCT: GCCACCATTTTTCAGAGTCCTG (sense), TTCCA CTTTTAACCCCTTCTTGC (antisense).

Antibodies. The following antibodies were used for western blotting: GGCT (6-1E; Cosmo, Tokyo, Japan); GAPDH (Wako); p21WAF1/CIP1 (BD Biosciences, Franklin Lakes, NJ, USA); p16INK4A (Abcam, Cambridge, MA, USA); p27 (Santa Cruz Biotechnology, Dallas, TX, USA); caspase-3, caspase-8, phospho-AKT (Ser473), AKT, AMPKa and phospho-AMPKa (Thr172) (Cell Signaling Technology, Danvers, MA, USA). Horse anti-mouse IgG-horseradish peroxidase conjugates were purchased from Vector Laboratories (PI-2000; Burlingame, CA, USA). Horseradish peroxidase-linked goat anti-rabbit IgG was purchased from the Jackson Laboratory (#7074; Bar Harbor, ME, USA). Antibody to GGCT for use in immunohistochemical analysis came from Proteintech (#16257-1-AP; Rosemont, IL, USA).

Western blot analysis. Proteins solubilized in 1% sodium dodecyl sulfate (SDS) lysis buffer were separated by SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene difluoride membranes (Millipore, Billerica, MA, USA). After blocking with 5% fat-free dried milk in Tris-buffered saline containing 0.05% Tween 20 or Blocking One-P (Nacalai Tesque, Kyoto, Japan), membranes were incubated with the antibodies detailed above. Targets were visualized using Clarity ECL Substrate (Bio-Rad, Hercules, CA, USA).

Cell-cycle analysis. At 72 h post ASO transfection, cells were washed and fixed with 70% ethanol at –20°C and stained with propidium iodide (PI) at 100 μg/ml in the presence of 100 μg/ml RNase A. The DNA content was analyzed using a BD LSRFortessa X-20 cell analyzer (BD Biosciences). At least 10,000 cells per sample were analyzed.

Bromodeoxyuridine (BrdU) incorporation assay. At 72 h post ASO transfection, the percentage of cells undergoing active DNA synthesis was examined using an APC BrdU flow kit (BD Biosciences) according to the manufacturer’s instructions. At least 10,000 cells from each experiment were analyzed using a BD LSRFortessa X-20 cell analyzer.

Apoptosis assay. At 72 h post ASO transfection, apoptosis induction was assessed using a MEBCYTO apoptosis kit (MBL, Nagoya, Japan). Annexin V-positive and PI-negative cells in the early phase of apoptosis were detected by flow cytometry using a BD LSRFortessa X-20 cell analyzer. At least 10,000 cells were analyzed for each experiment.

Measurement of reactive oxygen species (ROS). At 72 h post ASO transfection, cells were incubated with 10 mM 2’,7’-dichlorodihydrofluorescein diacetate dye (H2DCFDA) (Invitrogen) in culture media for 30 min. Then cells were resuspended in phosphate-buffered saline; intracellular ROS production was analyzed by flow cytometry. Mitochondrial ROS was measured using a MitoROS 580 kit, (#16052; AAT Bioquest, Sunnyvale, CA, USA).

Xenograft study and immunohistochemical analysis. All experiments were carried out under the approval of the Institutional Ethics Committee for Animal Experiments of Kyoto Pharmaceutical University (Approval number: CLON-19-001). Male CB-17 SCID mice (6 weeks old, n=4 per group) were purchased from Japan SLC (Shizuoka, Japan). Mice were subcutaneously inoculated on the lower sides of the trunk with 3×106 A549 cells. Mice were injected intraperitoneally with NEG-ASO-1 or GGCT-ASO-1 in 100 μl saline at a dose of 10 mg/kg twice a week for 4 weeks from the day after tumor cell inoculation. The tumor size was measured with vernier calipers twice a week for 4 weeks, and the tumor volume was calculated as (length×width2)×0.5. Standard immunohistochemical staining was performed using AEC reagent (Dako, Carpinteria, CA, USA).

Statistical analyses. A two-tailed Student’s t-test was used for comparing two groups, and a value of p<0.05 was considered significant. In vitro experimental results are expressed as the mean±S.D. In vivo experimental results are expressed as the mean±S.E.

Results

Validation of GGCT-ASOs in A549 cells. Firstly, we validated the knockdown effect of 16 newly designed GGCT-ASOs (Table I) at the mRNA level in A549 cells (data not shown). The knockdown effect of four selected GGCT-ASOs on the expression of GGCT protein was confirmed by western blot analysis (Figure 1A). We showed that GGCT-ASO-1 inhibited the proliferation of A549 cells using a dye-exclusion test (Figure 1B). A BrdU incorporation assay showed that GGCT knockdown more than halved the percentage of the BrdU-positive cells that entered into the DNA synthesis phase (Figure 1C). These findings indicate that ASO-mediated GGCT depletion suppresses the proliferation of A549 cells.

Figure 1.
Figure 1.

Antisense oligonucleotides (ASOs) targeting γ-glutamyl cyclotransferase (GGCT) inhibited A549 cell growth and caused cell-cycle arrest. A: Western blot analysis of GGCT and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression in A549 cells transfected with GGCT-targeting ASOs or NEG-ASO-1 (10 nM) for 3 days. B: Representative images of A549 cells transfected with GGCT-ASO-1 or NEG-ASO-1 (25 nM) and assessment of cell growth determined by cell counting (n=4). Scale bars, 100 μm. C: A549 cells were treated with ASOs (100 nM) for 3 days, and the proportion of bromodeoxyuridine (BrdU)-incorporating cells was assessed by flow cytometry (n=7). ***Significantly different at p<0.001. AAD: Amino-actinomycin D.

GGCT-ASO-1 induced apoptosis of A549 cells. We examined whether treatment with GGCT-ASO-1 induces apoptotic programmed cell death. Cell-cycle analyses by PI staining showed that GGCT-ASO-1 increased the sub-G1 population by more than fivefold (Figure 2A). Consistent with these results, western blot analyses showed that GGCT-ASO-1 induced cleavage of caspase-8 and caspase-3, indicating that GGCT-ASO-1 activated the apoptotic signaling pathway (Figure 2B). GGCT-ASO-1 also massively increased the percentage of annexin V-positive PI-negative cells, i.e., those in early apoptosis (Figure 2C). These results indicate that GGCT-ASO-1 treatment induces apoptosis of A549 cells.

Figure 2.
Figure 2.

γ-Glutamyl cyclotransferase (GGCT) knockdown induced apoptosis of A549 cells. A: A549 cells were treated with antisense oligonucleotides (ASOs) (25 nM) for 72 h, and the cell-cycle distribution was assessed using propidium iodide (PI) staining (n=5). B: Activation of caspase-3 and caspase-8 was assessed by western blotting. C: Quantitative analysis of A549 cells transfected with GGCT-ASO-1 or NEG-ASO-1 (50 nM) for 72 h. The graph shows the proportion of cells in early apoptosis (annexin V-positive PI-negative). Data are the mean±standard deviation (n=4). Significantly different at: *p<0.05, **p<0.01 and ***p<0.001.

GGCT-ASO-1 enhanced ROS production and activated AMPK in A549 cells. Next, we investigated the mechanisms underlying the antiproliferative action of GGCT-ASOs. Western blot analyses showed that GGCT-ASO-1 induced phosphorylation of AMPK expression, indicating that AMPK was activated (Figure 3A). Western blot analyses also revealed that GGCT-ASO-1 induced the protein expression of cyclin-dependent kinase inhibitors p21, p16, and p27 (Figure 3B), which are AMPK-dependently induced by GGCT depletion (13). AMPK is activated by mitochondrial ROS generation in embryonic fibroblasts (14). We found that GGCT-ASO-1 significantly increased the level of both intracellular ROS (Figure 3C) and mitochondrial ROS (Figure 3D) in A549 cells. These results suggest that GGCT-ASO-1 inhibits the proliferation of A549 cells by inducing ROS generation and AMPK activation, which increases the expression of cyclin-dependent kinase inhibitors.

Figure 3.
Figure 3.

Antisense oligonucleotide targeting γ-glutamyl cyclotransferase-1 (GGCT-ASO-1) induced the expression of cyclin-dependent kinase inhibitors, phosphorylation of AMP-activated protein kinase (AMPK), and up-regulation of reactive oxygen species (ROS). A: Western blot analysis of GGCT expression and activated (p-)AMPK in A549 cells transfected with GGCT-ASO-1 or NEG-ASO-1 (50 nM) for 72 h. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) is shown as a loading control. B: Western blot analysis of p21, p16, p27, and GGCT expression in A549 cells treated with ASOs (25 nM) for 72 h. GAPDH is shown as a loading control. Levels of cellular (n=4) (C) and mitochondrial (n=6) (D) ROS in A549 cells transfected with GGCT-ASO-1 or NEG-ASO-1 (50 nM) for 72 h. Levels were significantly different at p<0.05. FITC: Fluorescein isothiocyanate; PE: phycoerythrin.

Systemic administration of GGCT-ASO-1 suppressed the growth of A549 xenografts in vivo. Finally, we tested whether GGCT-ASO-1 treatment inhibited the growth of A549 xenografts in vivo. We found that intraperitoneal injection of GGCT-ASO-1 (10 mg/kg) significantly inhibited the growth of A549 xenograft tumors in immunodeficient mice (Figure 4A), without obvious adverse effects, such as reduction of body weight (data not shown). By western blot analysis of extracted proteins, we showed that GGCT expression was reduced in tumors from GGCT-ASO-1-treated mice but not in those from mice treated with NEG-ASO-1 (Figure 4B). Moreover, immunohistochemical staining of GGCT in tumor tissues from three mice in the NEG-ASO-1-treated and GGCT-ASO-1-treated groups showed that GGCT-ASO-1 suppressed GGCT expression (Figure 4C). These results indicate that GGCT-ASO-1 may suppress tumor progression in vivo.

Figure 4.
Figure 4.

Antisense oligonucleotide targeting γ-glutamyl cyclotransferase-1 (GGCT-ASO-1) inhibited tumor growth in mice bearing A549-cell tumors. A: A549 tumor cells were implanted into CB17 SCID mice, and NEG-ASO-1 or GGCT-ASO-1 was administered intraperitoneally twice a week (n=8 per group). The graph represents the tumor volume expressed as the mean±standard error (n=8). ***Significantly different at p<0.001. B: Western blot analysis confirming knockdown of GGCT expression. C: Representative images of immunohistochemical staining of GGCT in A549 tumors from mice treated with NEG-ASO-1 (n=3) and GGCT-ASO-1 (n=3). Scale bars, 100 μm.

Discussion

GGCT is a promising candidate as a molecular target for cancer treatment (15). To date, however, there is no effective GGCT-targeting nucleic acid medicine which can be systemically administered to inhibit tumor growth in vivo. In this study, we show that novel ASOs targeting GGCT inhibited the proliferation of A549 lung cancer cells. We provide evidence for the molecular mechanisms that underlie the antiproliferative effect of GGCT-ASO-1. GGCT-ASO-1 activated AMPK, which is a sensor protein for energy stress. AMPK activation causes various molecular phenomena, such as inhibition of cell growth and induction of apoptosis (16). Importantly, the generation of mitochondrial ROS activates AMPK via phosphorylation (14). Overproduction of ROS reduces the mitochondrial membrane potential, which in turn reduces cell viability, ultimately leading to apoptosis (17). Given the pivotal role of GGCT in aminoacid metabolism and glutathione homeostasis (15), it is conceivable that GGCT depletion causes metabolic distress by inducing oxidative stress.

We also demonstrate that GGCT-ASO-1 inhibited A549 xenograft growth in vivo. Our use of GGCT-ASO-1 takes advantage of an ASO formulation containing amido-bridged nucleic acids, which have improved stability and a better safety profile than conventional locked nucleic acid ASOs used without a drug delivery system (18). We previously showed that the GGCT enzymatic inhibitor pro-GA suppressed the growth of human prostate cancer cells (19). Together, these findings show that targeting GGCT using ASOs has potential as a novel lung cancer therapy.

In conclusion, this work shows that GGCT-ASO-1 has antiproliferative activity in NSCLC cells through induction of cell-cycle arrest and apoptosis, accompanied by mitochondrial ROS generation and AMPK activation. Moreover, systemic administration of GGCT-ASO-1 to A549-bearing mice inhibited xenograft growth. These results indicate that the use of GGCT-ASO-1 may be promising as a novel therapeutic strategy against NSCLC.

Acknowledgements

The Authors thank Dr. Tatsuhiro Yoshiki for providing scientific support. We also thank Maho Sugahara, Mayu Tanaka, Riku Tanaka, and Yuta Suzuki for experimental support.

Footnotes

  • Authors’ Contributions

    IH and YK performed the experiments and drafted the article. HY performed the experiments. SK, AK and SO designed the experiments. SN designed and supervised the study, and wrote the article.

  • Conflicts of Interest

    The Authors declare no conflicts of interest pertaining to the present study.

  • Received December 24, 2021.
  • Revision received January 14, 2022.
  • Accepted January 17, 2022.

References

  1. ↵
    1. Sung H,
    2. Ferlay J,
    3. Siegel RL,
    4. Laversanne M,
    5. Soerjomataram I,
    6. Jemal A and
    7. Bray F
    : Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 71(3): 209-249, 2021. PMID: 33538338. DOI: 10.3322/caac.21660
    OpenUrlCrossRefPubMed
  2. ↵
    1. Uras IZ,
    2. Moll HP and
    3. Casanova E
    : Targeting KRAS mutant non-small-cell lung cancer: past, present and future. Int J Mol Sci 21(12): 4325, 2020. PMID: 32560574. DOI: 10.3390/ijms21124325
    OpenUrlCrossRefPubMed
  3. ↵
    1. Kageyama S,
    2. Iwaki H,
    3. Inoue H,
    4. Isono T,
    5. Yuasa T,
    6. Nogawa M,
    7. Maekawa T,
    8. Ueda M,
    9. Kajita Y,
    10. Ogawa O,
    11. Toguchida J and
    12. Yoshiki T
    : A novel tumor-related protein, C7orf24, identified by proteome differential display of bladder urothelial carcinoma. Proteomics Clin Appl 1(2): 192-199, 2007. PMID: 21136669. DOI: 10.1002/prca.200600468
    OpenUrlCrossRefPubMed
  4. ↵
    1. Oakley AJ,
    2. Yamada T,
    3. Liu D,
    4. Coggan M,
    5. Clark AG and
    6. Board PG
    : The identification and structural characterization of C7orf24 as gamma-glutamyl cyclotransferase. An essential enzyme in the gamma-glutamyl cycle. J Biol Chem 283(32): 22031-22042, 2008. PMID: 18515354. DOI: 10.1074/jbc.M803623200
    OpenUrlAbstract/FREE Full Text
  5. ↵
    1. Gromov P,
    2. Gromova I,
    3. Friis E,
    4. Timmermans-Wielenga V,
    5. Rank F,
    6. Simon R,
    7. Sauter G and
    8. Moreira JM
    : Proteomic profiling of mammary carcinomas identifies C7orf24, a gamma-glutamyl cyclotransferase, as a potential cancer biomarker. J Proteome Res 9(8): 3941-3953, 2010. PMID: 20527979. DOI: 10.1021/pr100160u
    OpenUrlCrossRefPubMed
  6. ↵
    1. He Z,
    2. Wang S,
    3. Shao Y,
    4. Zhang J,
    5. Wu X,
    6. Chen Y,
    7. Hu J,
    8. Zhang F and
    9. Liu XS
    : Ras downstream effector GGCT alleviates oncogenic stress. iScience 19: 256-266, 2019. PMID: 31400748. DOI: 10.1016/j.isci.2019.07.036
    OpenUrlCrossRefPubMed
  7. ↵
    1. Taniguchi K,
    2. Matsumura K,
    3. Ii H,
    4. Kageyama S,
    5. Ashihara E,
    6. Chano T,
    7. Kawauchi A,
    8. Yoshiki T and
    9. Nakata S
    : Depletion of gamma-glutamylcyclotransferase in cancer cells induces autophagy followed by cellular senescence. Am J Cancer Res 8(4): 650-661, 2018. PMID: 29736310.
    OpenUrlPubMed
  8. ↵
    1. Fluiter K,
    2. ten Asbroek AL,
    3. de Wissel MB,
    4. Jakobs ME,
    5. Wissenbach M,
    6. Olsson H,
    7. Olsen O,
    8. Oerum H and
    9. Baas F
    : In vivo tumor growth inhibition and biodistribution studies of locked nucleic acid (LNA) antisense oligonucleotides. Nucleic Acids Res 31(3): 953-962, 2003. PMID: 12560491. DOI: 10.1093/nar/gkg185
    OpenUrlCrossRefPubMed
  9. ↵
    1. Yahara A,
    2. Shrestha AR,
    3. Yamamoto T,
    4. Hari Y,
    5. Osawa T,
    6. Yamaguchi M,
    7. Nishida M,
    8. Kodama T and
    9. Obika S
    : Amido-bridged nucleic acids (AmNAs): synthesis, duplex stability, nuclease resistance, and in vitro antisense potency. Chembiochem 13(17): 2513-2516, 2012. PMID: 23081931. DOI: 10.1002/cbic.201200506
    OpenUrlCrossRefPubMed
    1. Yamamoto T,
    2. Yahara A,
    3. Waki R,
    4. Yasuhara H,
    5. Wada F,
    6. Harada-Shiba M and
    7. Obika S
    : Amido-bridged nucleic acids with small hydrophobic residues enhance hepatic tropism of antisense oligonucleotides in vivo. Org Biomol Chem 13(12): 3757-3765, 2015. PMID: 25690587. DOI: 10.1039/c5ob00242g
    OpenUrlCrossRefPubMed
  11. ↵
    1. Kanda M,
    2. Kasahara Y,
    3. Shimizu D,
    4. Miwa T,
    5. Umeda S,
    6. Sawaki K,
    7. Nakamura S,
    8. Kodera Y and
    9. Obika S
    : Amido-bridged nucleic acid-modified antisense oligonucleotides targeting SYT13 to treat peritoneal metastasis of gastric cancer. Mol Ther Nucleic Acids 22: 791-802, 2020. PMID: 33230476. DOI: 10.1016/j.omtn.2020.10.001
    OpenUrlCrossRefPubMed
  12. ↵
    1. Hori S,
    2. Yamamoto T,
    3. Waki R,
    4. Wada S,
    5. Wada F,
    6. Noda M and
    7. Obika S
    : Ca2+ enrichment in culture medium potentiates effect of oligonucleotides. Nucleic Acids Res 43(19): e128, 2015. PMID: 26101258. DOI: 10.1093/nar/gkv626
    OpenUrlCrossRefPubMed
  13. ↵
    1. Taniguchi K,
    2. Ii H,
    3. Kageyama S,
    4. Takagi H,
    5. Chano T,
    6. Kawauchi A and
    7. Nakata S
    : Depletion of gamma-glutamylcyclotransferase inhibits cancer cell growth by activating the AMPK-FOXO3a-p21 axis. Biochem Biophys Res Commun 517(2): 238-243, 2019. PMID: 31345573. DOI: 10.1016/j.bbrc.2019.07.049
    OpenUrlCrossRefPubMed
  14. ↵
    1. Rabinovitch RC,
    2. Samborska B,
    3. Faubert B,
    4. Ma EH,
    5. Gravel SP,
    6. Andrzejewski S,
    7. Raissi TC,
    8. Pause A,
    9. St-Pierre J and
    10. Jones RG
    : AMPK maintains cellular metabolic homeostasis through regulation of mitochondrial reactive oxygen species. Cell Rep 21(1): 1-9, 2017. PMID: 28978464. DOI: 10.1016/j.celrep.2017.09.026
    OpenUrlCrossRefPubMed
  15. ↵
    1. Kageyama S,
    2. Ii H,
    3. Taniguchi K,
    4. Kubota S,
    5. Yoshida T,
    6. Isono T,
    7. Chano T,
    8. Yoshiya T,
    9. Ito K,
    10. Yoshiki T,
    11. Kawauchi A and
    12. Nakata S
    : Mechanisms of tumor growth inhibition by depletion of γ-glutamylcyclotransferase (GGCT): A novel molecular target for anticancer therapy. Int J Mol Sci 19(7): 2054, 2018. PMID: 30011933. DOI: 10.3390/ijms19072054
    OpenUrlCrossRefPubMed
  16. ↵
    1. Ozben T
    : Oxidative stress and apoptosis: impact on cancer therapy. J Pharm Sci 96(9): 2181-2196, 2007. PMID: 17593552. DOI: 10.1002/jps.20874
    OpenUrlCrossRefPubMed
  17. ↵
    1. Ahn J,
    2. Kim H and
    3. Yang KM
    : ω-hydroxyundec-9-enoic acid induction of breast cancer cells apoptosis through generation of mitochondrial ROS and phosphorylation of AMPK. Arch Pharm Res 43(7): 735-743, 2020. PMID: 32720162. DOI: 10.1007/s12272-020-01254-x
    OpenUrlCrossRefPubMed
  18. ↵
    1. Setoguchi K,
    2. Cui L,
    3. Hachisuka N,
    4. Obchoei S,
    5. Shinkai K,
    6. Hyodo F,
    7. Kato K,
    8. Wada F,
    9. Yamamoto T,
    10. Harada-Shiba M,
    11. Obika S and
    12. Nakano K
    : Antisense oligonucleotides targeting Y-box binding protein-1 inhibit tumor angiogenesis by downregulating Bcl-xL-VEGFR2/-Tie axes. Mol Ther Nucleic Acids 9: 170-181, 2017. PMID: 29246296. DOI: 10.1016/j.omtn.2017.09.004
    OpenUrlCrossRefPubMed
  19. ↵
    1. Takagi H,
    2. Ii H,
    3. Kageyama S,
    4. Hanada E,
    5. Taniguchi K,
    6. Yoshiya T,
    7. Chano T,
    8. Kawauchi A and
    9. Nakata S
    : Blockade of γ-glutamylcyclotransferase enhances docetaxel growth inhibition of prostate cancer cells. Anticancer Res 39(9): 4811-4816, 2019. PMID: 31519583. DOI: 10.21873/anticanres.13666
    OpenUrlAbstract/FREE Full Text
Back to top

In this issue

Print
Download PDF
Article Alerts
Email Article
Citation Tools
Reprints and Permissions
Administration of Gapmer-type Antisense Oligonucleotides Targeting γ-Glutamylcyclotransferase Suppresses the Growth of A549 Lung Cancer Xenografts
HIROMI II, YUUYA KASAHARA, HARUMI YAMAGUMA, SUSUMU KAGEYAMA, AKIHIRO KAWAUCHI, SATOSHI OBIKA, SUSUMU NAKATA
Anticancer Research Mar 2022, 42 (3) 1221-1227; DOI: 10.21873/anticanres.15589
Twitter logo Facebook logo Mendeley logo

Jump to section

Keywords