Research ArticleExperimental Studies
Open Access

Micro RNA miR-1303 Promotion of Proliferation, Migration and Invasion of Human Liver Cancer Cells Is Enhanced by Low Talin 1 (TLN1) Expression

JUN HUANG, QINGYUAN XI, JIE XIONG, HAO PENG, HAITAO YANG, YU SUN and ROBERT M. HOFFMAN
Anticancer Research October 2022, 42 (10) 4715-4725; DOI: https://doi.org/10.21873/anticanres.15976

Abstract

Background/Aim: Liver cancer is the third-most lethal cancer worldwide. Abnormal expression of microRNAs (miRNAs) modulates gene expression to exert oncogenic or tumor-suppressive effects in liver cancer. However, the biological role of miR-1303 in the progression of liver cancer and its regulatory mechanism has not been elucidated. Materials and Methods: The expression levels of miR-1303 were measured in liver-cancer tissues of patients and cell lines by RT-qPCR. Huh-7 and HepG2 liver-cancer cells were co-transfected by TLN1 and miR-1303 constructs. Cell viability was measured by the CCk-8 assay and colony-formation assay. Flow cytometry was used to measure cell apoptosis. Cell migration and invasion were determined by wound-healing and transwell-chamber assays. RT-PCR and western-blotting were used to determine miR-1303 inhibitor-associated marker expression, such as Bax, cleaved-caspase-3 and cleaved-caspase-9. Results: miR-1303 expression was strongly up-regulated in liver-cancer tissues and cells. Knockdown of miR-1303 attenuated cell proliferation, migration and invasion, and induced apoptosis in liver-cancer cells. Talin 1 (TLN1) and miR-1303 expression were negatively correlated, possibly by miR-1303 targeting the TLN1 gene. TLN1 expression enhanced the efficacy of an miR-1303 inhibitor to reduce liver-cancer cell proliferation and invasion. Conclusion: miR-1303 plays an important role in liver cancer, which is inhibited by TLN1 expression.

Key Words:

Liver cancer is the third-most lethal cancer worldwide and the second-largest cancer-related cause of death in China (1). The long-term survival rate for liver-cancer patients remains poor due to lack of effective treatment (2, 3). A greater understanding of the potential mechanism and progression of liver cancer is vital for developing more effective therapies.

Micro-RNAs (miRNAs) are a class of small noncoding RNAs with a length of approximately 20-24 nucleotides. miRNAs play a large part in modulating the expression of diverse genes participating in the progression of numerous cancer types, via regulating mRNA expression (4-6). Knockdown of miRNAs which target proto-oncogenes and ectopic expression of oncogenic miRNA, can inhibit or enhance cancer progression, respectively (7-11). miR-20b, miR-27a and miR-181a which regulate HIPK2, HIF1A and MDR1, respectively, were expressed in gastric cancer during chemotherapy (12). miRNAs are candidate biomarkers for diagnosis or prognosis of pancreatic cancer which are in critical need (13). miRNAs in the cells of the tumor microenvironment, have been suggested as a target for liver cancer (14). miR-182-5p promotes hepatocellular carcinoma progression by repressing FOXO3a (15). miR-3662 suppresses liver-cancer growth via inhibition of the HIF-1α-mediated Warburg Effect (16). miR-3 inhibited liver-cancer progression by targeting XRCC5 through the PI3K/AKT signaling pathway (17).

miRNA-1303 has been shown to promote a number of different cancer types (18, 19). However, the role of miR-1303 in liver cancer remains poorly understood. Thus, the regulatory role of miR-1303 in liver cancer needs to be further investigated.

We hypothesized that miR-1303 may act as a promotor of liver cancer, which was investigated in previous studies (18-20). In the present study, we evaluated the function and mechanism of miR-1303 on liver cancer progression, suggesting that miR-1303 is a potential biomarker for liver cancer.

Materials and Methods

Tissues samples. Liver cancer tissues (n=30) and adjacent normal tissues (n=30) were obtained from patients of the Anhui Medical University (Hefei, PR China) between June 2018 and June 2019. The patients did not receive radiotherapy or chemotherapy preoperatively. Tumor specimens were stored at −80°C.

Cell culture and transfection. Human liver-cancer cell lines Huh-7, MHCC97-H, and HepG2, as well as normal human-hepatocyte strain HL-7702 were obtained from the American Tissue Culture Collection (ATCC; Rockville, MD, USA). Cells were grown in DMEM supplemented with 10% fetal bovine serum (FBS) (Invitrogen, Carlsbad, CA, USA) at 37°C under a moist atmosphere of 5% CO2. MiR-1303 and negative-control (NC) inhibitors were purchased from GenePharma (Shanghai, PR China). Cell transfection was carried out using the Lipofectamine 2000 (Invitrogen) reagent.

CCK-8 cell-viability assay. Cell viability was measured with the CCk-8 assay (Beyotime, Shanghai, PR China). Huh-7 and HepG2 cells (1×104 cells/well in 50 μl culture medium) were cultured in 96-well plates. CCK-8 reagent (10 μl) was added to the culture at 24, 48 and 72 h, respectively, and incubated for an additional 4 h at 37°C. The absorbance at 450 nm was measured using a microplate reader (Bio-Rad, Shanghai, PR China).

Colony-formation assay. Colony formation analysis was carried out to determine the role of miR-1303 on Huh-7 and HepG2 cells. Briefly, 500 cells were cultured in 6-well plates containing 1 ml DMEM supplemented with 10% FBS. The medium was replaced every 3 days. Two weeks later, the medium was discarded and the cells were fixed in 4% paraformaldehyde, following staining with crystal violet for another 30 min. Colonies were counted and photographed with a light microscope (CX31, Olympus, Tokyo, Japan).

Flow cytometry assay. Flow cytometry was used to measure cell apoptosis. In brief, Huh-7 and HepG2 cells (1×104) were seeded in 24-well plates and cultured for 24 h. The cells were washed with phosphate buffered saline (PBS) twice. Annexin V-FITC (Invitrogen) and propidium iodide (PI) (Invitrogen) were added to the culture wells for 15 min at 37°C. Apoptotic cells were detected with FACScalibur Flow Cytometry (BD Biosciences, San Jose, CA, USA).

Wound-healing assay. A wound-healing assay was performed to determine cell-migration ability. Huh-7 and HepG2 cells were seeded in six-well plates and grown to 90% confluence. Wounds were produced by scratching the cell layer using pipette tips. Cultures were maintained for another 48 h. The wound-healing results were observed under an inverted microscope.

Transwell chamber assay. The migratory and invasion capability of cells was determined by transwell-chamber assays. Cells and serum-free medium were added to the upper chamber of the transwell plate (Corning, Cambridge, MA, USA), while the bottom chamber was supplemented with complete medium containing 10% FBS. Cells in both chambers were fixed with 4% paraformaldehyde, and then stained with 0.1% crystal violet. The cells were counted and imaged with a CX31 light microscope (Olympus).

Real-time quantitative PCR (RT-qPCR). The TRIzol reagent was used to extract the total RNA from tissues and cells. Detection of miR-1303 and mRNA expression was carried out with the TaqMan MicroRNA Assay Kit (Beyotime). The RNA was reverse transcribed into complementary DNA (cDNA) with the M-MLV Kit (Thermo Fisher Scientific, Carlsbad, CA, USA). Expression levels were amplified by RT-qPCR on an ABI Prism 7500 PCR system (Thermo Fisher Scientific). Relative mRNA expression was normalized to β-actin. Each sample was analyzed in triplicate and the relative expression level was calculated with the 2−ΔΔCT method. miR-1303 primers were as follows: forward TTTAGAGACGGGGTCTTGCTCT; reverse CAGTGCGT GTCGTGGAGT. U6 primers were as follows: forward CTCG CTTCGGCAGCACA; reverse AACGCTTCACGAATT TGCGT.

Western-blot assay. Total proteins from cells were extracted with RIPA lysate buffer (Beyotime). The BCA kit (Beyotime) was used to measure protein concentrations. Proteins were separated on 12% SDS-PAGE, and then transferred to PVDF membranes. Membranes were incubated with 5% skim milk for 1 h at 37°C, and then probed with the primary antibody at 4°C overnight, following treatment with horse-radish peroxide (HRP)-conjugated secondary antibody for 2 h at 37°C. Enhanced chemiluminescence (ECL) reagent (Thermo Fisher Scientific) was used visualize the proteins in a chemiluminescence instrument (Bio-Rad, Hercules, CA, USA). β-actin was used as an internal control. The data were quantified using Image J software (NIH, Bethesda, MD, USA). All antibodies were obtained from Abcam (Waltham, MA, USA), and were as follows: Bax (ab32503, 1:1,000); Bcl-2 (ab32124, 1:1,000); cleaved caspase-3 (ab2302, 1:1,000); cleaved caspase-9 (ab2324, 1:1,000); ICAM-1 (ab53013, 1:1,000); VCAM-1 (ab134047, 1:1,000); TLN1 (ab71333, 1:1,000); and β-actin (ab6276, 1:2,000).

TLN1 and miR-1303 constructs co-transfection. WT-TLN1-3′UTR or Mut-TLN1-3′UTR was inserted into psiCHECK-2 plasmids containing a luciferase reporter gene (Promega, Madison, WI, USA) to produce wild-type (WT)-TLN1 and mutant (Mut)-TLN1 constructs, respectively. Huh-7 and HepG2 cells were co-transfected with the indicated constructs and miR-1303 mimic or negative control (NC) mimic. miRNA mimics were chemically synthesized and mimic the high-level expression of mature miRNA in cells, enhance the regulation of endogenous miRNA, and are used in gain-of-function studies (21). The dual luciferase-reporter kit (Promega) was used to determine transfection of cells with the above-described constructs.

Statistical analysis. Data are expressed as means±SD and SPSS (19.0 version, SPSS, IBM, Inc., Armonk, NY, USA). GraphPad (6.0 version) was used for statistical analyses. Differences among multiple groups were analyzed with one-way analysis of variance (ANOVA) followed by Tukey’s test. The Student’s t-test was used to evaluate significant differences between two groups. p≤0.05 was indicated as statistically significant. All experiments were repeated three times.

Results

miR-1303 was highly expressed in liver-cancer tissues and cells. To investigate the role of miR-1303 in liver cancer, the expression levels of miR-1303 were measured in liver-cancer tissues and cell lines by RT-qPCR. miR-1303 expression was found to be significantly higher in liver-cancer tissues than in normal tissues (p=0.009) (Figure 1A). Similarly, miR-1303 was significantly up-regulated in liver-cancer cells compared to normal liver cells (p<0.01) (Figure 1B).

Figure 1.
Figure 1.

MiR-1303 expression is elevated in liver-cancer tissues and cells. (A) Relative expression of miR-1303 in liver-cancer tissue was measured by RT-qPCR. **p<0.01 vs. normal tissues. (B) Relative expression of miR-1303 in liver-cancer cell lines (Huh-7, MHCC97-H, and HepG2) and normal epithelial HL-7702 cells was measured by RT-qPCR. **p<0.01 vs. HL-7702.

Knockdown of miR-1303 inhibits cell proliferation and accelerates apoptosis of liver-cancer cells. miR-1303-inhibitor transfection significantly suppressed miR-1303 mRNA levels in Huh-7 (p=0.005) and HepG2 cells (p=0.004) (Figure 2A). Silencing miR-1303 expression decreased the viability of Huh-7 (p=0.032) and HepG2 (p=0.024) cells, compared to cells transfected with the negative control (NC) inhibitor (Figure 2B). miR-1303 knockdown significantly suppressed colony formation of Huh-7 (p=0.002) and HepG2 (p=0.008) cells, compared to the NC inhibitor (Figure 2C). Apoptosis was significantly increased in cells transfected with the miR-1303 inhibitor (p<0.01) (Figure 2D). Knockdown of miR-1303 expression increased Bax, cleaved-caspase-3 and cleaved-caspase-9, and decreased Bcl-2 expression levels (p<0.01) (Figure 2E). These results indicate that miR-1303 enhances the proliferation and suppresses apoptosis of liver-cancer cells.

Figure 2.
Figure 2.
Figure 2.

Knockdown of miR-1303 suppresses proliferation and induces apoptosis of liver-cancer cells. (A) Effect of miR-1303 inhibitor on expression of miR-1303. (B) Cell viability was determined by the CCK-8 assay. (C) The role of miR-1303 on cell proliferation was analyzed by a colony-formation assay (magnification, 40×). (D) Apoptosis was assessed by flow cytometry. (E) The expression of apoptosis regulatory proteins was analyzed using western blotting. **p<0.01 vs. NC inhibitor.

Knockdown of miR-1303 inhibits in vitro migration and invasion of liver-cancer cells. Cell-culture wound closure was significantly decreased in Huh-7 (p=0.042) and HepG2 (p=0.038) cells transfected with the miR-1303 inhibitor, compared to cells transfected with the NC inhibitor (Figure 3A). The miR-1303 inhibitor significantly decreased the invasion capability of liver-cancer cells compared to the NC inhibitor (p<0.01) (Figure 3B and C). Previous studies showed that the levels of ICAM-1 and VCAM-1 are higher in liver-cancer (22-24). The protein-expression levels of ICAM-1 and VCAM-1 were significantly decreased by the miR-1303 inhibitor compared to the NC inhibitor (p<0.01) (Figure 3D). These results indicated that miR-1303 knockdown suppressed migration and invasion of liver-cancer cells in vitro.

Figure 3.
Figure 3.

Knockdown of miR-1303 inhibits migration and invasion of liver-cancer cells. (A) The effects of miR-1303 on cell migration were determined by a wound-healing assay (magnification, 200×). (B, C) The effects of miR-1303 on cell migration and invasion were measured by a transwell-chamber assay (magnification, 200×). (D) Migration and invasion-related proteins were assessed by western blotting. *p<0.05, **p<0.01 vs. NC inhibitor.

Expression of TLN1 is negatively correlated with miR-1303. TLN1 as a potential target of miR-1303, was predicted by Targetscan (25) (Figure 4A). miR-1303 expression was negatively correlated with TLN1 expression (p<0.01) (Figure 4B), possibly by miR-1303 targeting of the TLN1 gene. TLN1 expression was lower in liver-cancer tissues than in the corresponding adjacent normal tissues. TLN1 in normal HL-7702 cells was more abundant than that of liver- cancer cell lines (Huh-7, MHCC97-H, and HepG2) (p<0.01) (Figure 4C). A negative correlation between miR-1303 expression and the level of TLN1 in liver-cancer specimens was found (r=−0.52, p=0.0042) (Figure 4D). Down-regulation of miR-1303 increased TLN1 expression (p<0.01) (Figure 4E and F). These results suggested that TLN1 expression may be inhibited by miR-1303 in liver cancer.

Figure 4.
Figure 4.

TLN1 and miR-1303 expression is negatively correlated in liver-cancer cells. (A) The predicted binding site of the 3′-UTR of TLN1. (B) Relative luciferase activity showed that miR-1303 mimic significantly suppressed TLN1 expression. **p<0.01 vs. NC mimic. (C) Relative expression of TLN1 in liver-cancer tissue was determined by RT-qPCR. **p<0.01 vs. normal tissues. The mRNA expression of TLN1 in liver-cancer cells was analyzed by RT-qPCR. **p<0.01, ***p<0.001 vs. HL-7702. (D) Correlation between miR-1303 and TLN1 expression. (E, F) The expression of TLN1 was analyzed by RT-qPCR and western blotting. **p<0.01 vs. NC inhibitor.

Knockdown of TLN1 reduces the efficacy of the miR inhibitor on preventing liver-cancer progression. The expression of TLN1 in HepG2 (p=0.008) and Huh7 (p=0.005) cells was knocked-down efficiently by transfection of sh-TLN1 (Figure 5A). sh-TLN1 RNA abrogated the anti-proliferation efficacy of the miR-1303 inhibitor (p<0.05) (Figure 5B and C). The miR-1303-inhibitor induction of apoptosis was decreased by sh-TLN1 (p<0.05) (Figure 5D). Also, silencing expression of TLN1 significantly reduced the miR-1303 inhibitor-associated increase of Bax, cleaved-caspase-3 and cleaved-caspase-9 expression (p<0.05) (Figure 5E). sh-TLN1 abrogated the effects of miR-1303 inhibitor-reduction of cell migration and invasion (p<0.05) (Figure 5F and G). These results suggest that miR-1303 enhances liver cancer progression by targeting TLN1.

Figure 5.
Figure 5.
Figure 5.

Effect of miR-1303 inhibitor and TLN1 expression on liver-cancer cell prolifieration, invasion, migration, and apoptosis. (A) The effect of transfection of sh-TLN1 was detected by RT-qPCR. **p<0.01 vs. sh-NC. (B-C) The role of miR-1303/TLN1 on cell proliferative was determined by CCK-8 cell-proliferation and colony-formation assays. (D) Apoptosis was determined by flow cytometry. (E) The expression of apoptosis-related proteins was determined by western blotting. (F, G) Transwell assays were used to assess the effect of miR-1303 and TLN1 on cell migration and invasion. **p<0.01 vs. NC inhibitor + sh-NC. #p<0.05 vs. miR-1303 inhibitor + sh-NC.

Discussion

In the present study, we demonstrated that miR-1303 is highly expressed in liver-cancer tissues and liver-cancer cell lines, and is associated with increased proliferation, migration and invasion, and decreased apoptosis of liver cancer cells. Consistent with these results, the miR-1303 inhibitor induced cell apoptosis, increased expression of Bax, cleaved caspase-3, cleaved caspase-9, and decreased Bcl-2. Down-regulation of miR-1303 also reduced cell migration and invasion, and attenuated ICAM-1 and VCAM-1 expression. The results indicated that miR-1303 was able to function as an oncogene in liver cancer.

The present study showed that TLN1 expression was negatively correlated with miR-1303 expression. The TLN1 gene encodes a cytoskeleton protein Talin 1, which can bind to integrin, vinculin, actin, focal adhesion kinase (FAK), PIP kinase and other cytoskeleton proteins and protein kinases. Therefore, TLN1 plays an important role in the coupling of integrins with cytoskeletal proteins and in mediating signal-transduction pathways (26). Recent studies have found that TLN1 expression is associated with invasion, metastasis or poor differentiation of oral squamous-cell carcinoma (27), reduced invasion and migration in liver cancer (28) and is associated with prostate-cancer bone metastasis (29). The present results suggest that miR-1303 promotes liver-cancer cell proliferation and inhibits apoptosis by targeting TLN1. TLN1 may be a liver-cancer suppressor and can partially reverse the effects of miR-1303. TLN1 knockdown reduced the efficacy of miR-1303 inhibition to reduce liver-cancer progression.

In conclusion, the present study demonstrated that miR-1303 promotes liver-cancer proliferation, migration, and invasion possibly by targeting TLN1 in liver-cancer cells. miR-1303 knockdown suppressed cell proliferation, invasion and enhanced cell apoptosis. The present study suggests that miR-1303/TLN1 could act as a potential target for liver-cancer treatment.

Footnotes

  • Authors’ Contributions

    JH designed and supervised the study; QX, JX, HP and HY performed the experiments; YS and HY analyzed the data; RMH revised the manuscript.

  • Conflicts of Interest

    The Authors declare no conflicts of interests in relation to the present study.

  • Received July 10, 2022.
  • Revision received August 12, 2022.
  • Accepted August 22, 2022.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY-NC-ND) 4.0 international license (https://creativecommons.org/licenses/by-nc-nd/4.0).

References

  1. ↵
    1. Siegel RL,
    2. Miller KD and
    3. Jemal A
    : Cancer statistics, 2018. CA Cancer J Clin 68(1): 7-30, 2018. PMID: 29313949. DOI: 10.3322/caac.21442
    OpenUrlCrossRefPubMed
  2. ↵
    1. Ghouri YA,
    2. Mian I and
    3. Rowe JH
    : Review of hepatocellular carcinoma: Epidemiology, etiology, and carcinogenesis. J Carcinog 16: 1, 2017. PMID: 28694740. DOI: 10.4103/jcar.JCar_9_16
    OpenUrlCrossRefPubMed
  3. ↵
    1. Fu L,
    2. Wu S,
    3. Yao T,
    4. Chen Q,
    5. Xie Y,
    6. Ying S,
    7. Chen Z,
    8. Xiao B and
    9. Hu Y
    : Decreased expression of hsa_circ_0003570 in hepatocellular carcinoma and its clinical significance. J Clin Lab Anal 32(2): e22239, 2018. PMID: 28493512. DOI: 10.1002/jcla.22239
    OpenUrlCrossRefPubMed
  4. ↵
    1. Islam F,
    2. Gopalan V,
    3. Vider J,
    4. Lu CT and
    5. Lam AK
    : MiR-142-5p act as an oncogenic microRNA in colorectal cancer: Clinicopathological and functional insights. Exp Mol Pathol 104(1): 98-107, 2018. PMID: 29337244. DOI: 10.1016/j.yexmp.2018.01.006
    OpenUrlCrossRefPubMed
    1. Lv T,
    2. Song K,
    3. Zhang L,
    4. Li W,
    5. Chen Y,
    6. Diao Y,
    7. Yao Q and
    8. Liu P
    : miRNA-34a decreases ovarian cancer cell proliferation and chemoresistance by targeting HDAC1. Biochem Cell Biol 96(5): 663-671, 2018. PMID: 29561664. DOI: 10.1139/bcb-2018-0031
    OpenUrlCrossRefPubMed
  6. ↵
    1. Zang Y,
    2. Yu R,
    3. Bai Y and
    4. Chen X
    : MicroRNA-9 suppresses cancer proliferation and cell cycle progression in acute lymphoblastic leukemia with inverse association of neuropilin-1. J Cell Biochem 119(8): 6604-6613, 2018. PMID: 29693748. DOI: 10.1002/jcb.26799
    OpenUrlCrossRefPubMed
  7. ↵
    1. Li GC,
    2. Cao XY,
    3. Li YN,
    4. Qiu YY,
    5. Li YN,
    6. Liu XJ and
    7. Sun XX
    : MicroRNA-374b inhibits cervical cancer cell proliferation and induces apoptosis through the p38/ERK signaling pathway by binding to JAM-2. J Cell Physiol 233(9): 7379-7390, 2018. PMID: 29575013. DOI: 10.1002/jcp.26574
    OpenUrlCrossRefPubMed
    1. Cheng F,
    2. Yang Z,
    3. Huang F,
    4. Yin L,
    5. Yan G and
    6. Gong G
    : microRNA-107 inhibits gastric cancer cell proliferation and metastasis by targeting PI3K/AKT pathway. Microb Pathog 121: 110-114, 2018. PMID: 29715534. DOI: 10.1016/j.micpath.2018.04.060
    OpenUrlCrossRefPubMed
    1. Han M,
    2. Wang Y,
    3. Guo G,
    4. Li L,
    5. Dou D,
    6. Ge X,
    7. Lv P,
    8. Wang F and
    9. Gu Y
    : microRNA-30d mediated breast cancer invasion, migration, and EMT by targeting KLF11 and activating STAT3 pathway. J Cell Biochem 119(10): 8138-8145, 2018. PMID: 29923255. DOI: 10.1002/jcb.26767
    OpenUrlCrossRefPubMed
    1. Xu K and
    2. Zhang L
    : Inhibition of TUG1/miRNA-299-3p axis represses pancreatic cancer malignant progression via suppression of the Notch1 pathway. Dig Dis Sci 65(6): 1748-1760, 2020. PMID: 31655908. DOI: 10.1007/s10620-019-05911-0
    OpenUrlCrossRefPubMed
  11. ↵
    1. Wang H,
    2. Tan Z,
    3. Hu H,
    4. Liu H,
    5. Wu T,
    6. Zheng C,
    7. Wang X,
    8. Luo Z,
    9. Wang J,
    10. Liu S,
    11. Lu Z and
    12. Tu J
    : microRNA-21 promotes breast cancer proliferation and metastasis by targeting LZTFL1. BMC Cancer 19(1): 738, 2019. PMID: 31351450. DOI: 10.1186/s12885-019-5951-3
    OpenUrlCrossRefPubMed
  12. ↵
    1. Danza K,
    2. Silvestris N,
    3. Simone G,
    4. Signorile M,
    5. Saragoni L,
    6. Brunetti O,
    7. Monti M,
    8. Mazzotta A,
    9. De Summa S,
    10. Mangia A and
    11. Tommasi S
    : Role of miR-27a, miR-181a and miR-20b in gastric cancer hypoxia-induced chemoresistance. Cancer Biol Ther 17(4): 400-406, 2016. PMID: 26793992. DOI: 10.1080/15384047.2016.1139244
    OpenUrlCrossRefPubMed
  13. ↵
    1. Brunetti O,
    2. Russo A,
    3. Scarpa A,
    4. Santini D,
    5. Reni M,
    6. Bittoni A,
    7. Azzariti A,
    8. Aprile G,
    9. Delcuratolo S,
    10. Signorile M,
    11. Gnoni A,
    12. Palermo L,
    13. Lorusso V,
    14. Cascinu S and
    15. Silvestris N
    : MicroRNA in pancreatic adenocarcinoma: predictive/prognostic biomarkers or therapeutic targets? Oncotarget 6(27): 23323-23341, 2015. PMID: 26259238. DOI: 10.18632/oncotarget.4492
    OpenUrlCrossRefPubMed
  14. ↵
    1. Gnoni A,
    2. Santini D,
    3. Scartozzi M,
    4. Russo A,
    5. Licchetta A,
    6. Palmieri V,
    7. Lupo L,
    8. Faloppi L,
    9. Palasciano G,
    10. Memeo V,
    11. Angarano G,
    12. Brunetti O,
    13. Guarini A,
    14. Pisconti S,
    15. Lorusso V and
    16. Silvestris N
    : Hepatocellular carcinoma treatment over sorafenib: epigenetics, microRNAs and microenvironment. Is there a light at the end of the tunnel? Expert Opin Ther Targets 19(12): 1623-1635, 2015. PMID: 26212068. DOI: 10.1517/14728222.2015.1071354
    OpenUrlCrossRefPubMed
  15. ↵
    1. Cao MQ,
    2. You AB,
    3. Zhu XD,
    4. Zhang W,
    5. Zhang YY,
    6. Zhang SZ,
    7. Zhang KW,
    8. Cai H,
    9. Shi WK,
    10. Li XL,
    11. Li KS,
    12. Gao DM,
    13. Ma DN,
    14. Ye BG,
    15. Wang CH,
    16. Qin CD,
    17. Sun HC,
    18. Zhang T and
    19. Tang ZY
    : miR-182-5p promotes hepatocellular carcinoma progression by repressing FOXO3a. J Hematol Oncol 11(1): 12, 2018. PMID: 29361949. DOI: 10.1186/s13045-018-0555-y
    OpenUrlCrossRefPubMed
  16. ↵
    1. Chen Z,
    2. Zuo X,
    3. Zhang Y,
    4. Han G,
    5. Zhang L,
    6. Wu J and
    7. Wang X
    : MiR-3662 suppresses hepatocellular carcinoma growth through inhibition of HIF-1α-mediated Warburg effect. Cell Death Dis 9(5): 549, 2018. PMID: 29748591. DOI: 10.1038/s41419-018-0616-8
    OpenUrlCrossRefPubMed
  17. ↵
    1. Ren F,
    2. Su H,
    3. Jiang H and
    4. Chen Y
    : Overexpression of miR-623 suppresses progression of hepatocellular carcinoma via regulating the PI3K/Akt signaling pathway by targeting XRCC5. J Cell Biochem 121(1): 213-223, 2020. PMID: 31190447. DOI: 10.1002/jcb.29117
    OpenUrlCrossRefPubMed
  18. ↵
    1. Zhang SJ,
    2. Feng JF,
    3. Wang L,
    4. Guo W,
    5. Du YW,
    6. Ming L and
    7. Zhao GQ
    : miR-1303 targets claudin-18 gene to modulate proliferation and invasion of gastric cancer cells. Dig Dis Sci 59(8): 1754-1763, 2014. PMID: 24647998. DOI: 10.1007/s10620-014-3107-5
    OpenUrlCrossRefPubMed
  19. ↵
    1. Li Z,
    2. Xu Z,
    3. Xie Q,
    4. Gao W,
    5. Xie J and
    6. Zhou L
    : miR-1303 promotes the proliferation of neuroblastoma cell SH-SY5Y by targeting GSK3β and SFRP1. Biomed Pharmacother 83: 508-513, 2016. PMID: 27434867. DOI: 10.1016/j.biopha.2016.07.010
    OpenUrlCrossRefPubMed
  20. ↵
    1. Navarro-Villarán E,
    2. de la Cruz-Ojeda P,
    3. Contreras L,
    4. González R,
    5. Negrete M,
    6. Rodríguez-Hernández MA,
    7. Marín-Gómez LM,
    8. Álamo-Martínez JM,
    9. Calvo A,
    10. Gómez-Bravo MA,
    11. de la Cruz J,
    12. Padillo J and
    13. Muntané J
    : Molecular pathways leading to induction of cell death and anti-proliferative properties by tacrolimus and mTOR inhibitors in liver cancer cells. Cell Physiol Biochem 54(3): 457-473, 2020. PMID: 32369692. DOI: 10.33594/000000230
    OpenUrlCrossRefPubMed
  21. ↵
    1. Xing S,
    2. Tian Z,
    3. Zheng W,
    4. Yang W,
    5. Du N,
    6. Gu Y,
    7. Yin J,
    8. Liu H,
    9. Jia X,
    10. Huang D,
    11. Liu W and
    12. Deng M
    : Hypoxia downregulated miR-4521 suppresses gastric carcinoma progression through regulation of IGF2 and FOXM1. Mol Cancer 20(1): 9, 2021. PMID: 33407516. DOI: 10.1186/s12943-020-01295-2
    OpenUrlCrossRefPubMed
  22. ↵
    1. Wadkin JCR,
    2. Patten DA,
    3. Kamarajah SK,
    4. Shepherd EL,
    5. Novitskaya V,
    6. Berditchevski F,
    7. Adams DH,
    8. Weston CJ and
    9. Shetty S
    : CD151 supports VCAM-1-mediated lymphocyte adhesion to liver endothelium and is upregulated in chronic liver disease and hepatocellular carcinoma. Am J Physiol Gastrointest Liver Physiol 313(2): G138-G149, 2017. PMID: 28473332. DOI: 10.1152/ajpgi.00411.2016
    OpenUrlCrossRefPubMed
    1. Yoong KF,
    2. McNab G,
    3. Hübscher SG and
    4. Adams DH
    : Vascular adhesion protein-1 and ICAM-1 support the adhesion of tumor-infiltrating lymphocytes to tumor endothelium in human hepatocellular carcinoma. J Immunol 160(8): 3978-3988, 1998. PMID: 9558106.
    OpenUrlAbstract/FREE Full Text
  24. ↵
    1. Iliaz R,
    2. Akyuz U,
    3. Tekin D,
    4. Serilmez M,
    5. Evirgen S,
    6. Cavus B,
    7. Soydinc H,
    8. Duranyildiz D,
    9. Karaca C,
    10. Demir K,
    11. Besisik F,
    12. Kaymakoglu S and
    13. Akyuz F
    : Role of several cytokines and adhesion molecules in the diagnosis and prediction of survival of hepatocellular carcinoma. Arab J Gastroenterol 17(4): 164-167, 2016. PMID: 27916547. DOI: 10.1016/j.ajg.2016.10.002
    OpenUrlCrossRefPubMed
  25. ↵
    1. Agarwal V,
    2. Bell GW,
    3. Nam JW and
    4. Bartel DP
    : Predicting effective microRNA target sites in mammalian mRNAs. Elife 4: e05005, 2015. PMID: 26267216. DOI: 10.7554/eLife.05005
    OpenUrlCrossRefPubMed
  26. ↵
    1. Wang Z,
    2. Zhu Z,
    3. Lin Z,
    4. Luo Y,
    5. Liang Z,
    6. Zhang C,
    7. Chen J and
    8. Peng P
    : miR-429 suppresses cell proliferation, migration and invasion in nasopharyngeal carcinoma by downregulation of TLN1. Cancer Cell Int 19: 115, 2019. PMID: 31068760. DOI: 10.1186/s12935-019-0831-0
    OpenUrlCrossRefPubMed
  27. ↵
    1. Lai MT,
    2. Hua CH,
    3. Tsai MH,
    4. Wan L,
    5. Lin YJ,
    6. Chen CM,
    7. Chiu IW,
    8. Chan C,
    9. Tsai FJ and
    10. Jinn-Chyuan Sheu J
    : Talin-1 overexpression defines high risk for aggressive oral squamous cell carcinoma and promotes cancer metastasis. J Pathol 224(3): 367-376, 2011. PMID: 21547905. DOI: 10.1002/path.2867
    OpenUrlCrossRefPubMed
  28. ↵
    1. Fang KP,
    2. Zhang JL,
    3. Ren YH and
    4. Qian YB
    : Talin-1 correlates with reduced invasion and migration in human hepatocellular carcinoma cells. Asian Pac J Cancer Prev 15(6): 2655-2661, 2014. PMID: 24761880. DOI: 10.7314/apjcp.2014.15.6.2655
    OpenUrlCrossRefPubMed
  29. ↵
    1. Jin JK,
    2. Tien PC,
    3. Cheng CJ,
    4. Song JH,
    5. Huang C,
    6. Lin SH and
    7. Gallick GE
    : Talin1 phosphorylation activates β1 integrins: a novel mechanism to promote prostate cancer bone metastasis. Oncogene 34(14): 1811-1821, 2015. PMID: 24793790. DOI: 10.1038/onc.2014.116
    OpenUrlCrossRefPubMed
Back to top

In this issue

Print
Download PDF
Article Alerts
Email Article
Citation Tools
Reprints and Permissions
Micro RNA miR-1303 Promotion of Proliferation, Migration and Invasion of Human Liver Cancer Cells Is Enhanced by Low Talin 1 (TLN1) Expression
JUN HUANG, QINGYUAN XI, JIE XIONG, HAO PENG, HAITAO YANG, YU SUN, ROBERT M. HOFFMAN
Anticancer Research Oct 2022, 42 (10) 4715-4725; DOI: 10.21873/anticanres.15976
Twitter logo Facebook logo Mendeley logo

Jump to section

Keywords