Research ArticleExperimental Studies

Let-7a Inhibits Tumor Metastasis by Regulating TGF-β/Smad Signaling in the Colorectal Adenocarcinoma Cell Line LS-174T

WEILAN CAO, QUANPENG WANG and CHONGJIE HUANG
Anticancer Research August 2021, 41 (8) 3801-3808; DOI: https://doi.org/10.21873/anticanres.15172

Abstract

Background/Aim: Colorectal adenocarcinoma has a poor prognosis due to its propensity for metastasis. It has been experimentally demonstrated that the microRNA (miRNA) let-7a can effectively inhibit tumor proliferation and metastasis by regulating the transforming growth factor (TGF)-β signaling pathway; however, limited research has been conducted in the area of on colorectal cancer. Herein, we aimed to clarify the role and regulation of let-7a in a colorectal adenocarcinoma cell line (LS-174T). Materials and Methods: LS-174T cells were transfected to express let-7a. Let-7a miRNA expression was detected by quantitative real-time polymerase chain reaction (RT-qPCR). Cell growth was assessed by methyl thiazolyl tetrazolium (MTT) assay; invasion and migration were examined by Matrigel invasion and wound healing assays. The expression levels of matrix metalloproteinase (MMP)-2, phosphorylated Drosophila mothers against decapentaplegic 2 (p-SMAD2), and TGF-β1 were analyzed by western blotting. The mRNA expression levels of TGFB1 were also analyzed by RT-qPCR. Results: Overexpression of let-7a resulted in significant inhibition of LS-174T cell proliferation in vitro. The invasion and migration abilities of the cells overexpressing let-7a were decreased, compared to the control group and miR-negative control group. Transfection of LS-174T cells with let-7a resulted in down-regulation of MMP-2, as well as of TGF-β1 and p-SMAD2 protein expression. Moreover, TGF-β1 mRNA levels were reduced following let-7a overexpression. Conclusion: Let-7a inhibited the growth and metastasis of colonic mucinous adenocarcinoma cells, at least partially, by regulating the TGF-β/Smad signaling pathway.

Key Words:

Colorectal cancer (CRC) is the third most common cancer worldwide and exhibits high morbidity (1, 2). The incidence of CRC has increased in recent years (3). Mucinous colorectal adenocarcinoma accounts for 15% of CRC cases and is prone to distant metastases, leading to reduced survival and poorer response to chemotherapy (4, 5).

TGF-β is a pluripotent cytokine, which plays a role in promoting cell differentiation, invasion, migration, and immune evasion (6-8). Although TGF-β can inhibit tumors early, it usually promotes tumor progression in late stages. Therefore, the metastasis-promoting function of TGF-β may predominate in cancer (8). Moreover, Yamamura et al. (9) found that the TGF-β signaling pathway is more active in human peritoneal metastases of ovarian cancer than in the primary lesion. Therefore, we presumed that regulation of the TGF-β1 signaling pathway could inhibit tumor cell growth and metastasis in colonic mucinous adenocarcinoma.

In addition, the MMP family promotes the degradation of extracellular matrix and plays a key role in the invasion and metastasis of tumor cells (10). ET Waas et al. investigated the levels of MMP-2 and MMP-9 in tissues from colorectal cancer patients and reported significantly higher levels of active MMP-2, proMMP-2, active MMP-9 and proMMP-9 in tumour tissues compared to normal mucosa.

MicroRNAs (miRNAs) are a class of non-coding, single-stranded, small RNA molecules that are approximately 22 nt in length. Owing to either partial or perfect base pairing with the 3’-untranslated regions (3’-UTRs) of target mRNAs, a single miRNA can regulate the expression of hundreds of target genes (11). A miRNA in the let-7 family was the second miRNA molecule discovered (12). There is evidence that let-7 expression is continuously and significantly reduced in tumors, suggesting that let-7 may act as a tumor suppressor in cancer cells, and that its restoration may be a useful therapeutic option in cancer (12, 13). Specifically, down-regulation of the let-7a gene has been recognized as a key event in the development of CRC (14).

It has been experimentally demonstrated that let-7a inhibits the proliferation and migration of prostate cancer cells by regulating the TGF-β/Smad signaling pathways (15). However, the mechanistic link between let-7 and TGF-β in colorectal mucinous adenocarcinoma remains elusive.

Therefore, in this study, we established let-7a overexpression models to study whether let-7a inhibits the growth and metastasis of the human colonic adenocarcinoma cell line LS-174T by regulating the TGF-β/Smad signaling pathways.

Materials and Methods

Cell line. The human LS-174T colon cancer cell line was obtained from the Institute of Cell Biology (Shanghai, PR China). The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM), purchased from Thermo-Fisher Scientific (Waltham, MA, USA), supplemented with 10% fetal bovine serum (FBS, Gibco, Thermo Fisher Scientific, Inc., Waltham, MA, USA). LS-174T cells were grown in an incubator containing 5% carbon dioxide and 95% oxygen at a constant temperature of 37˚C.

Cell transfection. Transfection was performed according to the manufacturer’s instructions. The LS-174T cells were cultured and allowed to adhere to 6-well plates at a density of 3×104 cells/well, followed by transfection with a lentivirus (GeneChem, Shanghai, PR China) expressing let-7a (let-7a mimic) or a negative control miRNA (miR-NC) with enhanced infection solution (GeneChem). The growth status and green fluorescence of the cells were assessed with a fluorescence microscope (Nikon, Shanghai, PR China). LS-174T cells were randomly divided into three groups: control group (non transfected LS-174T cells), miR-NC group, and let-7a mimic group.

MTT assay. MTT experiment were performed as described previously (16). LS-174T cells were counted using a hemocytometer and seeded into 96-well plates, with 1×104 viable cells per well. Cells were transfected with a lentivirus expressing let-7a or a negative control miRNA for 48 h, then growth and reproduction of the cells were assessed by adding MTT solution (Solarbio, Beijing, PR China) and incubating the cells at 37˚C for 4 h. Colorimetric measurements were performed at 560 nm by a microplate reader (Molecular Devices, Sunnyvale, CA, USA), and the growth rate was calculated.

Matrigel invasion assay. Matrigel invasion assays were performed with BD Matrigel 3422 (Corning, Inc., Corning, NY, USA) and Transwell 24-well insert (pore size: 8 μm; Corning, Inc.). LS-174T cells were collected by trypsinization and plated at 1×105 cells per well in DMEM without FBS in the top chambers of the 24-well plates. The lower chambers were filled with DMEM containing 15% FBS. The cells collected from the lower chambers were fixed in methanol for 30 min and stained with 0.1% crystal violet for 10 min.

Wound healing assay. LS-174T cells were seeded at 5×105 cells per well in a 6-well plate overnight. After the cells had covered each well, the medium was changed to DMEM without FBS for 12 h. Thereafter, wounds were simulated by making vertical scratches with a sterile pipette tip and eliminating the dislodged cells with phosphate-buffered saline (PBS). The cells were cultured under standard conditions of 37˚C and 5% carbon dioxide. Wound closure was measured 36 h later in each group, and the percentage relative to that in the control group (0 h) was calculated.

RT-qPCR assay. This assays were performed according to the manufacturer’s protocol. Total RNA was extracted with the RNAiso Plus kit (Takara, Ohtsu, Japan), and its integrity was assessed by electrophoresis with 1% agarose gel. Reverse transcription was performed using the PrimeScript RT reagent Kit with gDNA Eraser (Takara). The cDNA samples obtained were amplified by SYBR Premix Ex Taq (Takara) according to product specifications. The amplification procedure was as follows: 95˚C for 10 min, followed by 40 cycles of 95˚C for 5 s and 60˚C for 34 s. Subsequently, the samples were analyzed by quantitative PCR on an ABI 7500 Fast Dx Real-Time PCR Instrument (Applied Biosystems, Foster City, CA, USA). The target genes were normalized with the endogenous reference gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and the relative expression levels were determined by the formula 2-ΔΔCt. Each experiment was repeated three times. Let-7a expression analysis was performed using the Bulge-Loop miRNA RT-qPCR Starter Kit (RiboBio, Guangzhou, PR China), with U6 used as an internal control. Primers for analyzing TGFB1 and GAPDH were designed by Primer Express® Software Version 3.0 (Applied Biosystems). Primers are as follows: TGFB1 Forward (5’-3’), GTCAACTGTGGAGCAACACG, TGFB1 Reverse (5’-3’), GCAAATTCCATGGCACCGTC; GAPDH Forward (5’-3’), GCAAATTCCATGGCACCGTC, GAPDH Reverse (5’-3’), AGCATCGCCCCACTTGATTT.

Bulge-loop™ miRNA RT-qPCR Primer Sets (one RT primer and a pair of qPCR primers for each set) specific for let-7a were designed by RiboBio (Guangzhou, PR China).

Western blotting. The cells were lysed and centrifuged at 12,000 rpm for 10 min at 4˚C. Total protein was collected, and protein concentrations determined by the BCA Protein Assay Kit (CWBIO, Jiangsu, PR China). The treated protein samples were subjected to 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene fluoride (PVDF) membranes. After washing with Tris-buffered saline with Tween 20 (TBST) buffer, the blots were fully blocked using 5% skimmed milk for 2 h and incubated with antibodies against TGF-β1, p-SMAD2, MMP-2, SMAD2, and β-actin (Jackson ImmunoResearch Laboratories, Bar Harbor, ME, USA), overnight on a shaker at 4˚C. The membranes were washed thrice with TBST and incubated with horseradish peroxidase (HRP)-labeled goat anti-rabbit secondary antibody for 2 h. The membranes were washed three times in the same manner as described above, and the reactive bands were visualized with an ECL kit (Bio-Rad Laboratories Inc., Hercules, CA, USA). The images were scanned using a Gel Image System ver. 4.00 (Tanon, Shanghai, China) with β-actin as an internal reference and the results were expressed as gray values. Images of the blots were analyzed using ImageJ software (NIH, Bethesda, MD, USA).

Statistical analysis. Statistical analysis was performed with SPSS 19.0 (SPSS, Inc., Chicago, IL, USA). The data are presented as the mean±standard deviation (SD) value of three independent experiments. Students’ t-test was used when comparing the differences between the let-7a mimic and control groups (non-transfected control and miR-NC group). All p-values <0.05 were considered statistically significant.

Results

Overexpression of let-7a inhibited proliferation of LS-174T cells. LS-174T cells overexpressing let-7a were successfully constructed. Specifically, the expression of let-7a in let-7a mimic group was approximately 2-fold higher than that in control and miR-NC group (p<0.01; Figure 1A). We found that the number of LS-174T cells in the let-7a mimic group was significantly reduced as compared with that in the control groups (p<0.01). MTT assays showed that the let-7a overexpression significantly inhibited the proliferation by about 50% of LS-174T cells in vitro (Figure 1B).

Figure 1.
Figure 1.

Let-7a inhibited cell proliferation. Expression levels of let-7a in LS-174T cells as evaluated by quantitative real-time PCR (A). LS-174T cell viability was measured by MTT assay (B). All data were analyzed by Student’s t-test, n=3. *p<0.05; **p<0.01.

Overexpression of let-7a reduced invasion and migration of LS-174T cells. Wound healing experiments demonstrated that let-7a overexpression in LS-174T cells significantly inhibited cell migration (Figure 2A). Previous studies have shown that LS-174T cells are capable of invading a Matrigel matrix (17). In our study, the number of invasive cells in the let-7a mimic group was significantly reduced by over 60% as compared with that in the miR-NC and control groups (p<0.001; Figure 2B). Taken together, our results suggest that let-7a inhibits migration and invasion by LS-174T cells.

Figure 2.
Figure 2.

Let-7a decreased cancer cell invasion and migration capabilities. Cell migration was measured by a wound healing assay (A). The number of invasive cells was measured by Matrigel invasion assay (B). All the data were analyzed by Student’s t-test. *p<0.05; **p<0.01; ***p<0.001.

Overexpression of let-7a down-regulated MMP-2 expression in LS-174T cells. As shown in Figure 3, overexpression of let-7a in LS-174T cells resulted in reduced levels of MMP-2 protein as compared with those in the control cells (p<0.05). This indicated that let-7a inhibits metastasis by reducing the expression of MMP-2 in human colonic mucinous adenocarcinoma cells.

Figure 3.
Figure 3.

Expression of MMP-2 in LS-174T cells was evaluated by western blotting. A representative image of three experiments is shown. Data were analyzed by Student’s t-test. *p<0.05.

Overexpression of let-7a negatively regulated TGF-β1/Smad signaling pathway. We further hypothesized that let-7a exerts its anti-tumor effects by regulating the TGF-β1/Smad signaling pathway. Western blot results indicated that TGF-β1 and p-SMAD2 were down-regulated in cells transfected with the let-7a mimic as compared with the levels in the control and miR-NC groups (Figure 4A, p<0.05). Consistent with these findings, TGFB1 mRNA levels were lower in let-7a-overexpressing cells than in the control and miR-NC-transfected cells (Figure 4B). Overall, these results indicated that the up-regulation of let-7a decreased TGF-β1 expression at the mRNA and protein levels, resulting in the negative regulation of the TGF-β1/Smad signaling pathway.

Figure 4.
Figure 4.

Let-7a inactivates the TGF-β/Smad signaling pathway. Protein expression of TGF-β1 and p-SMAD2 was evaluated by western blotting. A representative image of three experiments is shown (A). The mRNA levels of TGF-β1 were assessed by RT-qPCR (B). All the data were analyzed by Student’s t-test, n=3. *p<0.05; **p<0.01.

Discussion

TGF-β is a multifunctional polypeptide cytokine that has important effects on cell growth, differentiation, adhesion, invasion, and the formation of extracellular matrix (18). The TGF-β/Smad signaling pathway may have profound roles in many cell types and diseases, such as cancer (19, 20). Experiments have shown that the combined inhibition of MMP-2 and TGF-β significantly reduces cell adhesion and invasion abilities (21, 22). Therefore, we hypothesized that regulation of these proteins may reduce viability and inhibit the progression of metastasis in colonic mucinous adenocarcinoma cells.

The discovery of miRNAs has greatly facilitated our understanding of the mechanisms regulating gene expression (23). miRNAs are known to play a key role in the development of human cancers (24, 25). For example, miR-200c mediates metastatic behavior in CRC (26), and the expression of miR-137 inhibits the proliferation, invasion, and metastasis of CRC cells, both in vitro and in vivo (27). Moreover, miR-27a acts as a tumor suppressor in cervical cancer, especially in adenocarcinoma, by inhibiting the TGF-βRI signaling pathway (28). The members of the let-7 miRNA family have been shown to be key regulators of bidirectionally transcribed genes (29) and have attracted attention following the experimental confirmation that let-7a is down-regulated in cancer cells. Accordingly, the up-regulation of let-7a promotes epithelial-mesenchymal transition in CRC cells and inhibits their ability to metastasize in vivo (30). Interestingly, there have been recent experimental reports that TGF-β significantly inhibits the expression of let-7 by inducing LIN28B transcription (31). However, little evidence is available on whether the up-regulation of let-7a in CRC inhibited the expression of TGF-β.

Our findings demonstrated the ability of let-7a to inhibit proliferation and metastasis in colorectal mucinous adenocarcinoma cells and confirmed an association between let-7a and the TGF-β signaling pathway. We showed that let-7a significantly inhibited the growth of LS-174T cells, reflecting its tumor suppressive effect in colonic mucinous adenocarcinoma. Moreover, reductions in cell migration, invasion, and the expression of MMP-2, as demonstrated by wound healing, Matrigel invasion, and western blotting assays, demonstrated that let-7a effectively inhibits the migration, invasion, and metastasis of LS-174T cells. These results are consistent with previous studies showing the tumor suppressive effects of let-7a in other cancers (15). Surprisingly, RT-qPCR and western blotting analyses revealed that let-7a inhibits tumor cell growth and metastasis by regulating the TGF-β1/Smad signaling pathway in human colonic mucinous adenocarcinoma cells. Therefore, it appeared that let-7a might have potential therapeutic value in the treatment of human colorectal mucinous adenocarcinoma.

Based on our findings, we propose a mechanism by which let-7a regulates TGF-β/Smad signaling to inhibit LS-174T cells proliferation and metastasis (Figure 5). After transfection of the cells with lentivirus expressing let-7a, TGF-β mRNA transcription is inhibited. Reduced TGF-β1 production subsequently leads to decreased Smad2/3 phosphorylation, which results in a reduction of MMP-2 expression in the downstream signaling pathway. Due to the fact that MMP-2 is closely related to tumors tissue migration, this situation may ultimately lead to inhibition of tumors tissue migration.

Figure 5.
Figure 5.

A summary model. Let-7a inhibits LS-174T cells proliferation and metastasis by regulating TGF-β/Smad signaling.

This study expands our understanding of the role of let-7a in human cancer. We propose that let-7a may be an innovative target for cancer treatment. However, the mechanism underlying the relationship between let-7a and the TGF-β1/Smad signaling pathways remains unknown. In addition, our study lacks reverse validation, because we did not determine whether we could reactivate the TGF-β1/Smad signaling pathway by reducing the expression of let-7a, and we did not verify whether an increase in TGF-β1 expression inhibits let-7a expression. Moreover, the present study was limited to cell-based experiments and lacked an in vivo component. As a family member of MMP and related to cell migration and invasion, MMP-9 is not included in this study. Therefore, in future studies, we would aim to identify the binding sites of both let-7a and TGF-β1, and to explore the mechanism of the relationship between let-7a and the TGF-β1/Smad signaling pathway based on dual fluorescence reporter experiments, in addition to verifying our results in animal models and explore whether MMP-9 is affected as shown for MMP-2.

In conclusion, our study indicates that let-7a overexpression significantly inhibits colon cancer cell growth and metastasis, in vitro, by negatively targeting the TGF-β1/Smad signaling pathway. This study may provide an effective treatment strategy for controlling tumor growth and metastasis in patients with colonic mucinous adenocarcinoma.

Acknowledgements

The Authors are grateful to RiboBio (Guangzhou, PR China) for assistance with RT-qPCR.

Footnotes

  • ↵* These Authors contributed equally to this work.

  • Authors’ Contributions

    Weilan Cao: Concept design, definition of intellectual content, literature search and experimental studies. Quanpeng Wang: Experimental studies, data acquisition, data analysis and statistical analysis and manuscript preparation. Chongjie Huang: Manuscript preparation, manuscript editing, and manuscript review.

  • Conflicts of Interest

    The Authors have no conflicts of interest.

  • Funding

    This work was supported by grants from the Research Fund for Lin He’s Academician Workstation of New Medicine and Clinical Translation (grant number 17331209); and the Science and Technology Project of Wenzhou Municipal Science and Technology Bureau (grant number Y20190578).

  • Received May 15, 2021.
  • Revision received June 21, 2021.
  • Accepted July 5, 2021.

References

  1. ↵
    1. Siegel R,
    2. Naishadham D and
    3. Jemal A
    : Cancer statistics, 2013. CA Cancer J Clin 63(1): 11-30, 2013. PMID: 23335087. DOI: 10.3322/caac.21166
    OpenUrlCrossRefPubMed
  2. ↵
    1. Torre LA,
    2. Bray F,
    3. Siegel RL,
    4. Ferlay J,
    5. Lortet-Tieulent J and
    6. Jemal A
    : Global cancer statistics, 2012. CA Cancer J Clin 65(2): 87-108, 2015. PMID: 25651787. DOI: 10.3322/caac.21262
    OpenUrlCrossRefPubMed
  3. ↵
    1. Siegel RL,
    2. Miller KD and
    3. Jemal A
    : Cancer statistics, 2017. CA Cancer J Clin 67(1): 7-30, 2017. PMID: 28055103. DOI: 10.3322/caac.21387
    OpenUrlCrossRefPubMed
  4. ↵
    1. Andrici J,
    2. Farzin M,
    3. Sioson L,
    4. Clarkson A,
    5. Watson N,
    6. Toon CW and
    7. Gill AJ
    : Mismatch repair deficiency as a prognostic factor in mucinous colorectal cancer. Mod Pathol 29(3): 266-274, 2016. PMID: 26769140. DOI: 10.1038/modpathol.2015.159
    OpenUrlCrossRefPubMed
  5. ↵
    1. Emile SH,
    2. Magdy A,
    3. Elnahas W,
    4. Hamdy O,
    5. Abdelnaby M and
    6. Khafagy W
    : Predictors for local recurrence and distant metastasis of mucinous colorectal adenocarcinoma. Surgery, 2018. PMID: 29361368. DOI: 10.1016/j.surg.2017.11.028
    OpenUrlCrossRefPubMed
  6. ↵
    1. Shao T,
    2. Song P,
    3. Hua H,
    4. Zhang H,
    5. Sun X,
    6. Kong Q,
    7. Wang J,
    8. Luo T and
    9. Jiang Y
    : Gamma synuclein is a novel Twist1 target that promotes TGF-β-induced cancer cell migration and invasion. Cell Death Dis 9(6): 625, 2018. PMID: 29795373. DOI: 10.1038/s41419-018-0657-z
    OpenUrlCrossRefPubMed
    1. Wrighton KH,
    2. Lin X and
    3. Feng XH
    : Phospho-control of TGF-beta superfamily signaling. Cell Res 19(1): 8-20, 2009. PMID: 19114991. DOI: 10.1038/cr.2008.327
    OpenUrlCrossRefPubMed
  8. ↵
    1. Zhang Y,
    2. Alexander PB and
    3. Wang XF
    : TGF-β family signaling in the control of cell proliferation and survival. Cold Spring Harb Perspect Biol 9(4): a022145, 2017. PMID: 27920038. DOI: 10.1101/cshperspect.a022145
    OpenUrlAbstract/FREE Full Text
  9. ↵
    1. Yamamura S,
    2. Matsumura N,
    3. Mandai M,
    4. Huang Z,
    5. Oura T,
    6. Baba T,
    7. Hamanishi J,
    8. Yamaguchi K,
    9. Kang HS,
    10. Okamoto T,
    11. Abiko K,
    12. Mori S,
    13. Murphy SK and
    14. Konishi I
    : The activated transforming growth factor-beta signaling pathway in peritoneal metastases is a potential therapeutic target in ovarian cancer. Int J Cancer 130(1): 20-28, 2012. PMID: 21503873. DOI: 10.1002/ijc.25961
    OpenUrlCrossRefPubMed
  10. ↵
    1. Waas ET,
    2. Lomme RM,
    3. DeGroot J,
    4. Wobbes T and
    5. Hendriks T
    : Tissue levels of active matrix metalloproteinase-2 and -9 in colorectal cancer. Br J Cancer 86(12): 1876-1883, 2002. PMID: 12085179. DOI: 10.1038/sj.bjc.6600366
    OpenUrlCrossRefPubMed
  11. ↵
    1. Hanna JA,
    2. Garcia MR,
    3. Lardennois A,
    4. Leavey PJ,
    5. Maglic D,
    6. Fagnan A,
    7. Go JC,
    8. Roach J,
    9. Wang YD,
    10. Finkelstein D and
    11. Hatley ME
    : PAX3-FOXO1 drives miR-486-5p and represses miR-221 contributing to pathogenesis of alveolar rhabdomyosarcoma. Oncogene 37(15): 1991-2007, 2018. PMID: 29367756. DOI: 10.1038/s41388-017-0081-3
    OpenUrlCrossRefPubMed
  12. ↵
    1. Yu F,
    2. Yao H,
    3. Zhu P,
    4. Zhang X,
    5. Pan Q,
    6. Gong C,
    7. Huang Y,
    8. Hu X,
    9. Su F,
    10. Lieberman J and
    11. Song E
    : let-7 regulates self renewal and tumorigenicity of breast cancer cells. Cell 131(6): 1109-1123, 2007. PMID: 18083101. DOI: 10.1016/j.cell.2007.10.054
    OpenUrlCrossRefPubMed
  13. ↵
    1. Boyerinas B,
    2. Park SM,
    3. Hau A,
    4. Murmann AE and
    5. Peter ME
    : The role of let-7 in cell differentiation and cancer. Endocr Relat Cancer 17(1): F19-F36, 2010. PMID: 19779035. DOI: 10.1677/ERC-09-0184
    OpenUrlCrossRefPubMed
  14. ↵
    1. Wang F,
    2. Zhang P,
    3. Ma Y,
    4. Yang J,
    5. Moyer MP,
    6. Shi C,
    7. Peng J and
    8. Qin H
    : NIRF is frequently upregulated in colorectal cancer and its oncogenicity can be suppressed by let-7a microRNA. Cancer Lett 314(2): 223-231, 2012. PMID: 22018986. DOI: 10.1016/j.canlet.2011.09.033
    OpenUrlCrossRefPubMed
  15. ↵
    1. Zhao B,
    2. Lu YL,
    3. Yang Y,
    4. Hu LB,
    5. Bai Y,
    6. Li RQ,
    7. Zhang GY,
    8. Li J,
    9. Bi CW,
    10. Yang LB,
    11. Hu C,
    12. Lei YH,
    13. Wang QL and
    14. Liu ZM
    : Overexpression of lncRNA ANRIL promoted the proliferation and migration of prostate cancer cells via regulating let-7a/TGF-β1/ Smad signaling pathway. Cancer Biomark 21(3): 613-620, 2018. PMID: 29278879. DOI: 10.3233/CBM-170683
    OpenUrlCrossRefPubMed
  16. ↵
    1. Rodriguez LG,
    2. Wu X and
    3. Guan JL
    : Wound-healing assay. Methods Mol Biol 294: 23-29, 2005. PMID: 15576902. DOI: 10.1385/1-59259-860-9:023
    OpenUrlCrossRefPubMed
  17. ↵
    1. Jiang PC,
    2. Zhu L,
    3. Fan Y and
    4. Zhao HL
    : Clinicopathological and biological significance of cripto overexpression in human colon cancer. World J Gastroenterol 19(46): 8630-8637, 2013. PMID: 24379580. DOI: 10.3748/wjg.v19.i46.8630
    OpenUrlCrossRefPubMed
  18. ↵
    1. Wang X,
    2. Sun W,
    3. Zhang C,
    4. Ji G,
    5. Ge Y,
    6. Xu Y and
    7. Zhao Y
    : TGF-β1 inhibits the growth and metastasis of tongue squamous carcinoma cells through Smad4. Gene 485(2): 160-166, 2011. PMID: 21726607. DOI: 10.1016/j.gene.2011.06.023
    OpenUrlCrossRefPubMed
  19. ↵
    1. Bertero A,
    2. Brown S,
    3. Madrigal P,
    4. Osnato A,
    5. Ortmann D,
    6. Yiangou L,
    7. Kadiwala J,
    8. Hubner NC,
    9. de Los Mozos IR,
    10. Sadée C,
    11. Lenaerts AS,
    12. Nakanoh S,
    13. Grandy R,
    14. Farnell E,
    15. Ule J,
    16. Stunnenberg HG,
    17. Mendjan S and
    18. Vallier L
    : The SMAD2/3 interactome reveals that TGFβ controls m6A mRNA methylation in pluripotency. Nature 555(7695): 256-259, 2018. PMID: 29489750. DOI: 10.1038/nature25784
    OpenUrlCrossRefPubMed
  20. ↵
    1. Gaarenstroom T and
    2. Hill CS
    : TGF-β signaling to chromatin: how Smads regulate transcription during self-renewal and differentiation. Semin Cell Dev Biol 32: 107-118, 2014. PMID: 24503509. DOI: 10.1016/j.semcdb.2014.01.009
    OpenUrlCrossRefPubMed
  21. ↵
    1. Hassona Y,
    2. Cirillo N,
    3. Heesom K,
    4. Parkinson EK and
    5. Prime SS
    : Senescent cancer-associated fibroblasts secrete active MMP-2 that promotes keratinocyte dis-cohesion and invasion. Br J Cancer 111(6): 1230-1237, 2014. PMID: 25117810. DOI: 10.1038/bjc.2014.438
    OpenUrlCrossRefPubMed
  22. ↵
    1. Pitiyage GN,
    2. Slijepcevic P,
    3. Gabrani A,
    4. Chianea YG,
    5. Lim KP,
    6. Prime SS,
    7. Tilakaratne WM,
    8. Fortune F and
    9. Parkinson EK
    : Senescent mesenchymal cells accumulate in human fibrosis by a telomere-independent mechanism and ameliorate fibrosis through matrix metalloproteinases. J Pathol 223(5): 604-617, 2011. PMID: 21341274. DOI: 10.1002/path.2839
    OpenUrlCrossRefPubMed
  23. ↵
    1. Yang Q,
    2. Jie Z,
    3. Cao H,
    4. Greenlee AR,
    5. Yang C,
    6. Zou F and
    7. Jiang Y
    : Low-level expression of let-7a in gastric cancer and its involvement in tumorigenesis by targeting RAB40C. Carcinogenesis 32(5): 713-722, 2011. PMID: 21349817. DOI: 10.1093/carcin/bgr035
    OpenUrlCrossRefPubMed
  24. ↵
    1. Ahn JH,
    2. Lee HS,
    3. Lee JS,
    4. Lee YS,
    5. Park JL,
    6. Kim SY,
    7. Hwang JA,
    8. Kunkeaw N,
    9. Jung SY,
    10. Kim TJ,
    11. Lee KS,
    12. Jeon SH,
    13. Lee I,
    14. Johnson BH,
    15. Choi JH and
    16. Lee YS
    : nc886 is induced by TGF-β and suppresses the microRNA pathway in ovarian cancer. Nat Commun 9(1): 1166, 2018. PMID: 29563500. DOI: 10.1038/s41467-018-03556-7
    OpenUrlCrossRefPubMed
  25. ↵
    1. Shi XH,
    2. Li X,
    3. Zhang H,
    4. He RZ,
    5. Zhao Y,
    6. Zhou M,
    7. Pan ST,
    8. Zhao CL,
    9. Feng YC,
    10. Wang M,
    11. Guo XJ and
    12. Qin RY
    : A five-microRNA signature for survival prognosis in pancreatic adenocarcinoma based on TCGA data. Sci Rep 8(1): 7638, 2018. PMID: 29769534. DOI: 10.1038/s41598-018-22493-5
    OpenUrlCrossRefPubMed
  26. ↵
    1. Hur K,
    2. Toiyama Y,
    3. Takahashi M,
    4. Balaguer F,
    5. Nagasaka T,
    6. Koike J,
    7. Hemmi H,
    8. Koi M,
    9. Boland CR and
    10. Goel A
    : MicroRNA-200c modulates epithelial-to-mesenchymal transition (EMT) in human colorectal cancer metastasis. Gut 62(9): 1315-1326, 2013. PMID: 22735571. DOI: 10.1136/gutjnl-2011-301846
    OpenUrlAbstract/FREE Full Text
  27. ↵
    1. Liang L,
    2. Li X,
    3. Zhang X,
    4. Lv Z,
    5. He G,
    6. Zhao W,
    7. Ren X,
    8. Li Y,
    9. Bian X,
    10. Liao W,
    11. Liu W,
    12. Yang G and
    13. Ding Y
    : MicroRNA-137, an HMGA1 target, suppresses colorectal cancer cell invasion and metastasis in mice by directly targeting FMNL2. Gastroenterology 144(3): 624-635.e4, 2013. PMID: 23201162. DOI: 10.1053/j.gastro.2012.11.033
    OpenUrlCrossRefPubMed
  28. ↵
    1. Fang F,
    2. Huang B,
    3. Sun S,
    4. Xiao M,
    5. Guo J,
    6. Yi X,
    7. Cai J and
    8. Wang Z
    : miR-27a inhibits cervical adenocarcinoma progression by downregulating the TGF-βRI signaling pathway. Cell Death Dis 9(3): 395, 2018. PMID: 29531222. DOI: 10.1038/s41419-018-0431-2
    OpenUrlCrossRefPubMed
  29. ↵
    1. Singh I,
    2. Contreras A,
    3. Cordero J,
    4. Rubio K,
    5. Dobersch S,
    6. Günther S,
    7. Jeratsch S,
    8. Mehta A,
    9. Krüger M,
    10. Graumann J,
    11. Seeger W,
    12. Dobreva G,
    13. Braun T and
    14. Barreto G
    : MiCEE is a ncRNA-protein complex that mediates epigenetic silencing and nucleolar organization. Nat Genet 50(7): 990-1001, 2018. PMID: 29867223. DOI: 10.1038/s41588-018-0139-3
    OpenUrlCrossRefPubMed
  30. ↵
    1. Cheng L,
    2. Geng L,
    3. Dai B,
    4. Zheng T,
    5. Fu J,
    6. Qiao L,
    7. Cai W,
    8. Wang Y and
    9. Yang J
    : Repression of let-7a cluster prevents adhesion of colorectal cancer cells by enforcing a mesenchymal phenotype in presence of liver inflammation. Cell Death Dis 9(5): 489, 2018. PMID: 29695839. DOI: 10.1038/s41419-018-0477-1
    OpenUrlCrossRefPubMed
  31. ↵
    1. Ottaviani S,
    2. Stebbing J,
    3. Frampton AE,
    4. Zagorac S,
    5. Krell J,
    6. de Giorgio A,
    7. Trabulo SM,
    8. Nguyen VTM,
    9. Magnani L,
    10. Feng H,
    11. Giovannetti E,
    12. Funel N,
    13. Gress TM,
    14. Jiao LR,
    15. Lombardo Y,
    16. Lemoine NR,
    17. Heeschen C and
    18. Castellano L
    : TGF-β induces miR-100 and miR-125b but blocks let-7a through LIN28B controlling PDAC progression. Nat Commun 9(1): 1845, 2018. PMID: 29748571. DOI: 10.1038/s41467-018-03962-x
    OpenUrlCrossRefPubMed
Back to top

In this issue

Print
Download PDF
Article Alerts
Email Article
Citation Tools
Reprints and Permissions
Let-7a Inhibits Tumor Metastasis by Regulating TGF-β/Smad Signaling in the Colorectal Adenocarcinoma Cell Line LS-174T
WEILAN CAO, QUANPENG WANG, CHONGJIE HUANG
Anticancer Research Aug 2021, 41 (8) 3801-3808; DOI: 10.21873/anticanres.15172
Twitter logo Facebook logo Mendeley logo

Jump to section

Keywords