Effects of HOXA9 Inhibitor DB818 on the Growth of Acute Myeloid Leukaemia Cells

Materials and Methods

Cell lines and HOXA9 inhibitor. Most experiments were conducted with three human AML cell lines. The OCI/AML3 cell line, which harbours NPM1 mutations, was established at the Ontario Cancer Institute (7). MV4-11 cells carrying MLL–ALL1-fused gene from chromosome 4 (AF4) (KMT2A–AFF1) and THP-1 cells carrying MLL–AF9 (KMT2A–MLLT3) fusion genes were purchased from the American Type Culture Collection (Manassas, VA, USA) and the European Collection of Authenticated Cell Cultures (Salisbury, UK), respectively. We also investigated the growth of six other AML cell lines and three acute lymphoblastic leukaemia (ALL) cell lines: HL60 (AML-M2), NB4 (AML-M3), OCI/AML2, OCI/AML5 (AML-M4), U937 (AML-M5), AA (AML-M6), Jurkat, KOPT-K1 (T-ALL), and NALM-6 (B-ALL); their characteristics are presented in the cell line guidebook (8) and our previous report (9). NB4 was provided by Dr. M. Lanotte (France). AA was provided by Dr. A. Arai (Japan). Jurkat and KOPT-K1 were gifted from Drs. Harashima and Orita (Fujisaki Cell Centre, Japan). All cell lines, except HL60, were confirmed to express HOXA9 by immunoblotting (data not shown). Normal lymphocytes from three healthy volunteers who provided informed consent were also used.

The HOXA9 inhibitor DB818 was purchased from Glixx Laboratories Inc. (Hopkinton, MA, USA) and dissolved in dimethyl sulfoxide (DMSO) to a final concentration of 5 mM.

Cell growth assay. Short-term cell growth was evaluated using a colorimetric WST-8 assay kit (Dojindo Laboratories, Kumamoto, Japan). Cells were cultured in 96-well plates in RPMI-1640 medium supplemented with 10% foetal bovine serum, with 10 or 20 μM DB818; after 96 h, WST-8 was added and the optical density was measured in an enzyme-linked immunosorbent assay reader. Relative cell proliferation was calculated as the percentage of the mean optical density value normalized to that of control cells cultured with vehicle (DMSO). In some experiments, cells were harvested after 96 h and counted under a microscope. Cell morphology was analysed in cytospin preparations stained with Wright stain and observed under a microscope.

Flow cytometric analysis. The effects of DB818 on cell differentiation were examined by staining cells with phycoerythrin-conjugated antibodies against CD11b and control IgG1 (BD Biosciences, Franklin Lakes, NJ, USA), whereas those on apoptosis were evaluated after staining with annexin V-fluorescein isothiocyanate and propidium iodide. The stained cells were analysed by flow cytometry in a FACSCalibur system (BD Biosciences).

Electrophoretic mobility shift assay (EMSA). Nuclear extracts from cells cultured with 10 or 20 μM DB818 or vehicle for 2 days were incubated with a biotin-labelled HOXA9 consensus oligonucleotide (CTGCGATGATTTACGACCGC) in the binding buffer from the Lightshift Chemiluminescent EMSA Kit (Pierce Biotechnology, Rockford, IL, USA). For specific competition, a 200-fold excess of the unlabelled probe was added. The samples were separated on 6% polyacrylamide gels, transferred to membranes, and the labelled bands were detected by chemiluminescence on X-ray films.

Immunoblotting analysis. Cell lysates were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis and analysed by immunoblotting with antibodies against HOXA9 (Merck, Darmstadt, Germany), BCL2, MYB, and MYC (Cell Signaling Technology, Danvers, MA, USA); anti-GAPDH (FUJIFILM Wako Pure Chemical Corp., Osaka, Japan) was used for loading control. Immunoreactive bands were qualitatively detected using Pierce Enhanced Chemiluminescent Western Blotting Substrate (Pierce Biotechnology). Each assay was repeated at least three times to ensure reproducibility.

HOXA9 knockdown by siRNA. HOXA9 knockdown was performed with three different pre-designed HOXA9-specific siRNAs (Stealth siRNA™; Life Technologies, Carlsbad, CA, USA): HSS 142495 (5’-GCUUCCAGUCCAAGGCGACGGUGUU-3’), HSS 142496 (5’-CCCAGCGAAGGCGCCUUCUCUGAAA-3’), and HSS 142497 (5’-GGUACGAGGUGGCUCGACUGCUCAA-3’); a Stealth RNAi negative control duplex was used as a control. Cells were transfected with each siRNA using the Neon™ pipette tip chamber-based electroporation system (Life Technologies) and immediately transferred to the culture medium.

Quantitative reverse transcription polymerase chain reaction. Total RNA was extracted from cells transfected with HOXA9 siRNA or control siRNA, and used to synthesize complementary DNA. Quantitative reverse transcription polymerase chain reaction was performed with FastStart Essential DNA Green Master mix (Roche Diagnostics, Mannheim, Germany) and HOAXA9-specific primers (QuantiTect Primer Assay QT01002372; QIAGEN, Hilden, Germany). The relative expression of HOXA9 mRNA was determined after normalization to that of β-actin-encoding (ACTB) mRNA (Roche Diagnostics).

Microarray analysis. Comprehensive gene-expression analysis was performed using microarray. Cells were treated with 20 μM DB818, DMSO (vehicle), 80 nM HOXA9 siRNA, or control siRNA for 24 h. Total RNA was then extracted with the High Pure RNA isolation kit (Roche Diagnostics) and used to prepare cyanine-3-labelled cRNA, which was hybridized to a SurePrint G3 Human GE microarray 8×60K v3 (Agilent Technologies, Santa Clara, CA, USA). The expression profile was analysed with the Agilent Feature Extraction 11.5.1.1 software.

Statistical analysis. Statistical significance of differences in cell growth was evaluated by Student’s t-test and p-values less than 0.05 were considered to indicate significant difference.