Abstract
Background/Aim: This study aimed to explore RGS2 as a regulator of melanoma cell growth. Materials and Methods: Effect of RGS2 over-expression was analyzed in three melanoma cell lines, and Rgs2 knockdown was performed in zebrafish. Results: RGS2 was differentially expressed among the cell lines. In B16F10 cells, RGS2 over-expression inhibited MAPK and AKT activation, and prevented cell growth. A similar outcome was observed in A375 cells, but the MAPK signals were not suppressed. In A2058 cells, RGS2 repressed AKT activation, but without affecting cell growth. Moreover, MAPK and AKT constitutive activation abolished the RGS2 inhibitory effect on B16F10 cell growth. Rgs2 knockdown caused ectopic melanocyte differentiation, and promoted MAPK and AKT activation in zebrafish embryos. Conclusion: RGS2 prevents melanoma cell growth by inhibiting MAPK and AKT, but this effect depends on the overall cell genetic landscape. Further studies are warranted to investigate the anticancer therapeutic potential of RGS2 for melanoma.
Melanoma is one of the most serious types of skin cancer that confers an increased risk for metastasis and causes a precipitous drop in survival rate. Particularly, patients with metastatic melanoma have a median survival of only 6 to 10 months (1). Melanoma cells share many cellular and molecular characteristics with neural crest cells and neural crest-derived melanocyte precursors, suggesting that abnormal proliferation and differentiation of these progenitors and precursors can lead to the development of melanoma. Indeed, many genetic pathways have been demonstrated to be important for both melanocyte development and melanoma growth (2). RAF-MAP2K-MAPK, PI3K-AKT, and WNT signaling pathways are major molecular regulators of the pathogenesis of melanomas, and irregular activation of these signaling pathways can cause proliferation, invasion, and metastasis of melanoma cells. Therefore, molecules in these pathways have been subjected to pharmacological studies to treat this disease (3). Mutations in the v-Raf murine sarcoma viral oncogene homolog B1 (BRAF) is commonly observed in melanomas, and the V600E mutation (BRAFV600E) is the most common, accounting for 70% to 88% of all BRAF mutations and in 40% to 50% of human melanoma, leading to over-activation of the MAPK pathway (4, 5). However, human nevi also frequently express BRAFV600E (6), suggesting that gene mutations in addition to MAPK signaling are involved in the development of malignancy. Therefore, identifying the genetic, molecular, and cellular regulation of melanoma is crucial for improving our diagnostic tools and developing novel therapeutics for this life-threatening disease.
G protein-coupled receptors (GPCRs) have been implicated in embryogenesis, tissue remodeling and repair, inflammation, angiogenesis, and cancer growth (7). Altered expression or mutations in GPCRs or G proteins are involved in nearly all tumor progression processes such as transformation, growth, survival, angiogenesis, and metastasis. Many GPCRs and G proteins, such as melanocortin type 1 receptor (MC1R), endothelin receptors (EDNR), frizzled receptor, chemokine receptor (CXCR), protease-activated receptor-1 (PAR-1), platelet-activating factor receptor (PAFR), metabotropic glutamate receptor 1 (GRM1), and Gαq and Gα11, have been shown to play a role in melanoma development and progression (7, 8). However, the molecular mechanisms underlying the function of GPCRs in melanoma remain unclear. Ligand binding to GPCRs causes GDP-Gα to be replaced with GTP-Gα and initiates G-protein-mediated signaling, whereas GTPase hydrolyzes GTP and deactivates the signaling. Regulators of G protein signaling (RGS) family proteins accelerate the intrinsic GTPase activity and hydrolysis of GTP and negatively regulate G-protein signaling (9, 10). More than 20 mammalian RGS proteins have been identified, all of which share a conserved RGS domain that is responsible for accelerating GTPase activity. These proteins are classified into several subfamilies based on sequence homology and the presence of additional domains alongside the RGS domain (11, 12). Aberrant RGS expression is commonly observed in cancers, and RGS proteins can either promote or inhibit tumor growth depending on the type of tumor cells and RGS protein (13). Given the fact that RGS proteins negatively regulate G-protein signaling, RGSs may have potential use as therapeutic molecules that can inhibit GPCR or G protein signaling-induced tumors. However, the physiological and pathological roles of RGS proteins in tumor growth need to be further studied.
RGS2 is a member of the R4/B RGS family of proteins, and it preferentially interferes with signals mediated via Gαs and Gαq/11 subunits, while having only a minor impact on Gαi (14, 15). RGS2 has attracted the attention of many researchers due to its implications in anxiety disorders (16), hypertension (17), and tumor progression (18-20). We demonstrated that Rgs2 is a key factor in regulating the formation of neural crest progenitors, ectomesenchyme, and non-ectomesenchyme neural crest derivatives (21), reinforcing the idea that Rgs2/RGS2 may regulate melanocyte development and melanoma formation. In this study, we examined the role of RGS2 in vitro using three types of melanoma cell lines with different genetic contents. In addition, certain attributes of zebrafish make it appropriate for the study of melanoma and melanocyte biology (6). Zebrafish melanocytes are externally visible, and single cells can be visualized in living animals. Many studies have shown correlations between genes that regulate neural crest and melanocyte development and those that contribute to melanoma (2). In addition, the genomic features of zebrafish melanoma are highly similar to those of human melanoma (6). Accordingly, we used zebrafish as an in vivo model to examine the role of RGS2/Rgs2 (RGS2 in mammals and Rgs2 in zebrafish) in melanocyte development.
Materials and Methods
Melanoma cell culture and lipofection. The mouse melanoma cell line B16F10 and human melanoma cell lines A375 and A2058 were grown in D-MEM medium (GIBCO, Thermo Fisher Scientific, TAQKEY Science, Taipei, Taiwan, ROC), supplemented with 2 mM L-glutamine, 10% bovine serum albumin, 100 U/ml penicillin, and 100 μg/ml streptomycin. Cells were grown as adherent monolayers in 10 cm cell culture dishes in a 5% CO2 atmosphere. The cells were transfected with Lipofectamine (DreamFectTM Gold, OZ Biosciences, Watson Biotechnology Co., Ltd Taipei, Taiwan, ROC).
Ethics statement and zebrafish maintenance. All experiments were performed in strict accordance with the standard guidelines for zebrafish work and approved by the Institutional Animal Care and Use Committee of Chang Gung University (IACUC approval number: CGU108-105). Tü (wild type) zebrafish embryos were purchased from the Zebrafish International Resource Center (Eugene, OR, USA) and were raised, maintained, and paired under standard conditions. The embryos were staged according to somite numbers, hours post-fertilization, and days post-fertilization (22).
RGS2 constructs and semiquantitative RT-PCR. The open reading frames of human RGS2 were PCR-amplified using primers and the 2X Super Hi-Fi Taq PCR MasterMix (BIOTOOLS, Taipei, Taiwan, ROC), subjected to sub-cloning, and purified using the TOOLS Plasmid Mini kit (BIOTOOLS). Cells were homogenized in TRIzol reagent (Invitrogen, TAQKEY Science, Taipei, Taiwan, ROC), and total RNA was extracted using a standard method. cDNA was synthesized from total RNA using an oligo(dT)20 primer and the RevertAid First Strand cDNA Synthesis Kit (Fermentas, TAQKEY Science). The resulting cDNA was used for PCR amplification in a reaction mixture containing high-fidelity Pfu polymerase (Thermo Fischer Scientific, TAQKEY Science) and primer sets. The following thermal cycling program was employed: 5 min at 94 C, followed by 30 cycles of 30 s at 94°C for 40 s, 58°C, and 72°C for 5 min. PCR-generated DNA fragments were resolved on Tris-borate-buffered 1.5% agarose gels and visualized by ethidium bromide staining. RT-PCR signals were quantitatively evaluated using AlphaVIEW SA image analysis software (ProteinSimple Inc., San Jose, CA, USA), and the values of the targets were normalized to those of internal controls to express arbitrary units of relative expression.
Western blot. Before lysis, the cells were washed once with cold phosphate-buffered saline (PBS). Total cell lysates were prepared by adding RIPA lysis buffer (Hycell, Taipei, Taiwan, ROC) containing protease inhibitors (Hycell). Total protein was separated on bis-acrylamide gels and transferred to polyvinylidene fluoride membranes (Merck, Taipei, Taiwan, ROC). Membranes were blocked by incubation with anti-phospho-Akt (Ser473) (Cell Signaling, TAIGEN Bioscience, Taipei, Taiwan), anti-Akt (Cell Signaling, TAIGEN Bioscience), anti-phospho-MAPK3/1 (Cell Signaling, TAIGEN Bioscience), anti-MAPK3/1 (Cell Signaling, TAIGEN Bioscience), anti-Myc (9E10, COVANCE, Union Biomed, Taipei, Taiwan, ROC), or anti-α-tubulin (Sigma Aldrich, UNI-ONWARD, Taipei, Taiwan, ROC) antibodies. A horseradish peroxidase (HRP)-conjugated secondary antibody (Invitrogen, TAQKEY Science) was applied before the images were visualized.
WST-1 assay. The WST-1 assay was used to determine the effects on melanoma cell viability after transfection. Cells were cultured in 96–well plates at an initial density of 3,000 cells per well in 100 μl of DMEM containing 1% FBS. At each time point, cell viability was determined using a WST-1 Kit (Merck), and the absorbance at 450 nm was measured using a universal microplate spectrophotometer.
Injection of rgs2 constructs and morpholino. Capped RNA encoding the complete coding sequences of rgs2 and rgs2Δ159 was prepared as described previously (23). Antisense morpholino oligonucleotides were purchased from Gene Tools (Philomath, OR, USA). The rgs2 morpholino that targeted the 5’ end to the ATG start codon of rgs2 (-28 to -4, TATCAATCAAATTGAGCTGAAATGT) (21) was used. All injections were performed at the one-cell or two-cell stage, and cRNAs or morpholinos were introduced into blastomeres.
Statistical analysis. Quantitative data are presented as the mean±SD, determined from the indicated number of experiments. The statistical analysis was based on Student’s t-test for comparing two groups and one-way ANOVA for multiple comparisons. Statistical significance was set at p<0.05. All reactions were performed in triplicate for each sample.
Results
RGS2 suppresses melanoma cell growth. We used RT-PCR to examine RGS2 expression in mouse melanoma B16F10 cells expressing wild-type BRAF. Rgs2 expression was undetectable in B16F10 cells (Figure 1A), while strong expression of genes encoding G-proteins (Gna11, Gna12, Gna13, Gnaq) (Figure 1A) was observed. The undetectable Rgs2 expression was accompanied by a strong expression of Mitf (a master regulator of melanocyte and melanoma development) (Figure 1A), suggesting that reduced expression of RGS2 is required for B16F10 cell growth. Indeed, transfection of RGS2 reduced the growth of B16F10 cells, as determined by the WST-1 assay (Figure 1D). This result demonstrates that RGS2 can suppress the growth of B16F10 melanoma cells.
Next, we examined the expression of RGS2 in A375 and A2058 human melanoma cells. A375 are malignant melanoma cells with a basal expression of MAPK1 and MAPK3, high EGFR levels, and homozygous for BRAFV600E mutation. We observed that RGS2 expression was higher, whereas that of GNA11, GNA12, GNA13, and GNAQ was relatively lower in A375 cells, compared with B16F10 cells (Figure 1B). The WST-1 assay revealed that RGS2 transfection inhibited A375 growth (Figure 1E); however, the inhibitory effect was not as significant as that observed in B16F10 cells (Figure 1D and E). This result demonstrated that RGS2 expression could inhibit melanoma growth in A375 cells with a strong oncogenic background (EGFR and BRAF activation).
A2058 human metastatic melanoma cells express nerve growth factor (NGF) and carry BRAFV600E, MAP2K1P124S, and TP53V274F mutations, and thus are resistant to both BRAF and MAP2K inhibitors (24). RGS2, GNA12, GNA13, GNAQ, and MITF expression in A2058 cells was the highest among all three cell lines analyzed (Figure 1C). The WST-1 assay revealed that RGS2 transfection did not alter the viability of A2058 cells (Figure 1F), suggesting that over-expression of RGS2 in cells with high levels of RGS2 background expression could not further inhibit the growth of A2058 cells.
RGS2 reduces the growth of melanoma cells via inhibition of MAPK and AKT signaling pathways. We further investigated the potential downstream regulators of G protein signaling in melanoma progression. RAF-MAP2K-MAPK and PI3K-AKT are the major signaling pathways that are regulated by GPCR signaling (25-29), and activating mutations in both of these pathways have been observed in cultured melanoma cells and melanoma samples from patients (30, 31). Accordingly, we measured the expression of phosphorylated-MAPK1/3 (pMAPK1/3) and phosphorylated-AKT1 (pAKT1) using western blotting with specific antibodies in melanoma cell lines transfected with RGS2. The results demonstrated that RGS2 significantly reduced the expression levels of pMAPK1/3 and pAKT1 in B16F10 cells (Figure 2A). In contrast, RGS2 over-expression in A375 and A2058 cells resulted in reduced levels of pAKT, whereas the levels of pMAPK1/3 were unaffected (Figure 2B and C). This result indicated that activation of both MAPK and AKT signaling is essential for melanoma cell growth, and RGS2 over-expression inhibited pAKT but not pMAPK and consequently limited its ability to reduce the growth of A375 and A2058 cells (Figure 2 and Figure 3). Because RGS2 is expressed in A375 and A2058 cells but not in B16F10 cells (Figure 1), our results suggest that over-expression of RGS2 in the presence of endogenous RGS2 had a limited effect in reducing pMAPK activity, and the effect of RGS2 in inhibiting melanoma cell growth is most effective in the absence of endogenous RGS2 expression.
The effect of RGS2 on cell growth was most notable in B16F10 cells carrying wild-type BRAF and AKT compared to A375 and A2058 cell lines carrying the BRAFV600E mutation, which constitutively activates the RAF-MAP2K-MAPK pathway (Figure 2). Accordingly, we examined the role of RGS2 in regulating MAPK and AKT signaling and mediating melanoma cell growth in B16F10 cells. We first confirmed that activation of MAPK and AKT signaling is essential for melanoma cell growth by inhibiting MAP2K-MAPK or PI3K-AKT signaling using U0126 (MAP2K1/2 inhibitor) or LY294002 (PI-3K inhibitor), respectively. Both U0126 and LY294002 reduced the growth of B16F10 cells (Figure 3A). Next, to further confirm that RGS2 regulates MAPK and AKT signaling involved in melanoma cell growth, we induced MAPK and AKT signaling via a constitutively active form of MAP2K1 (CA-MAP2K1, formerly known as CA-MEK1) (32) and a constitutively active form of AKT1 (CA-AKT1) (33, 34), in RGS2 transfected background. Concomitant transfection of RGS2 with CA-MAP2K1 or CA-AKT1 abolished the inhibitory effect of RGS2 on B16F10 cell growth (Figure 3B), confirming that RGS2 reduces the growth of B16F10 cells by inhibiting the MAPK and AKT signaling pathways.
Rgs2 is required to inhibit melanocyte development in zebrafish. Zebrafish embryos express endogenous Rgs2. As seen in A375 and A2058 cells, over-expression of RGS2 was not effective in a genetic background with endogenous RGS2 expression (Figure 1). Accordingly, over-expression of Rgs2 in zebrafish embryos may also not affect melanocyte differentiation. Therefore, we performed a loss-of-function approach by interfering with endogenous Rgs2 expression using morpholino (MO) knockdown and a dominate-negative rgs2 deletion variant (rgs2Δ159) (21). We discovered that the number of melanocytes was upregulated from 72 h to 120 h post-fertilization (hpf) in Rgs2-deficient zebrafish larvae (Figure 4). This result indicated that Rgs2 is essential for the inhibition of melanocyte formation. In addition, Rgs2 knockdown increased pMAPK and pAKT expression levels, which correlated with the increase in the melanocyte phenotype (Figure 5). This result confirmed that Rgs2 deficiency induced MAPK and AKT activation in vivo and consequently induced melanocyte differentiation.
Discussion
Melanoma is a complex form of skin cancer whose etiology may involve alterations in several pathways controlling normal neural crest and melanocytic growth. Despite numerous clinical and molecular efforts directed towards the treatment and prevention of this disease, the precise genetic lesions leading to melanoma remain to be discovered. We identified a novel regulator, RGS2, that can inhibit melanoma growth. We demonstrated that RGS2 inhibits melanoma growth by inhibiting MAPK and AKT activation; however, the effect is highly dependent on the genetic background of each type of melanoma cell since different degrees of inhibitory effect in three types of melanoma cells were observed (a hypothetical model is illustrated in Figure 6).
Activation of the MAPK pathway starts from the binding of extracellular mitogens to membrane receptors, followed by activation of RAS-GTP and consequent activation of MAP3K (such as BRAF) and the downstream kinases MAP2K and MAPK. Approximately 50% of melanomas harbor V600E/K mutations in BRAF. Here, we revealed that RGS2 inhibited MAPK and AKT activation and reduced the growth of B16F10 cells (Figure 6B). RGS2 also reduced A375 cell growth; however, in this cell line, RGS2 inhibited AKT activation but was not able to suppress MAPK activation. This can be explained by the fact that A375 cells carrying the BRAFV600E mutation are characterized by constitutively activated MAPK signaling (Figure 6C). Inhibition of AKT activation was sufficient to reduce A375 cell growth, suggesting that AKT activation is essential for melanoma growth. In A2058 cells, RGS2 had no effect on the inhibition of cell growth, which can be explained by the fact that this cell line also contains BRAFV600E, MAP2K1P124S, and TP53V274F mutations (35) (Figure 6D).
Our results confirmed that MAPK and AKT signaling were sufficient to induce melanoma growth. Indeed, over-expression or activation of AKT signaling is a common factor in melanoma growth and metastasis (36), and activated AKT signaling supports the constant growth of melanoma in the presence of drugs targeting BRAFV600E (37). BRAF inhibitors have been effective in treating melanoma; however, the majority of patients who rely on BRAF inhibitor monotherapy relapse and show limited improvement in survival. Recently, a combination of drugs targeting BRAF (dabrafenib) and MAP2K (trametinib) has substantially improved outcomes in these patients (5, 38, 39). Our results suggest that BRAF inhibitors combined with drugs targeting AKT (such as ipatasertib) could be a potential strategy to sufficiently reduce melanoma growth. We demonstrated in in vitro and in vivo settings that RGS2 can inhibit both MAPK and AKT activation and reduce melanoma growth. In addition, our results further suggest that RGS2 has potential as a diagnostic and therapeutic molecular marker to distinguish certain subtypes of melanomas and may guide the selection of treatment, owing to the different expression levels of RGS2 and the effect of RGS2 over-expression in the three cell lines analyzed in this study.
Acknowledgements
The Authors would like to thank the Taiwan Zebrafish Core facility at ZeTH and the Zebrafish Core in Academia Sinica for providing the experimental fish.
Footnotes
↵* These Authors contributed equally to this work.
Authors’ Contributions
Conceptualization, YCH and YCC; Methodology, SJL, YCH, HYC, JYF, SYH, and YCC; Investigation, SJL, YCH, HYC, HYS, YCL, NTZ, and YCC; Resources, JYF and SYH; Data Curation, SJL, YCH, HYC; Writing – Original Draft, YCC; Writing – Review & Editing, SJL, YCH, HYC, and HYC; Visualization, HYC and YCC; Supervision, YCH and YCC; Project Administration, YCC; Funding Acquisition, YCH and YCC.
Conflicts of Interest
The Authors declare that they have no competing interests in relation to this study.
Funding
This work was supported by grants from Chang Gung Medical Foundation and Chang Gung Memorial Hospital (CMRPD1K0171, CMRPD1K0172, and BMRP857 for YCC; CORPG3J0261 and CORPG 3J0262 for YCH), the Ministry of Science and Technology, Taiwan (MOST 110-2320-B-182 -008 -MY3 for YCC; NMRPG3J6141 and NMRPG3J6142 for YCH).
- Received September 14, 2021.
- Revision received October 31, 2021.
- Accepted November 1, 2021.
- Copyright © 2021 International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.