Research ArticleExperimental Studies

Discovery of a Novel Chemical Scaffold Against Mutant Isocitrate Dehydrogenase 1 (IDH1)

CHUNG HYO KANG, SANG UN CHOI, YOU HWA SON, HEUNG KYOUNG LEE, HYE GWANG JEONG, CHANG-SOO YUN, SUNJOO AHN and CHI HOON PARK
Anticancer Research September 2020, 40 (9) 4929-4935; DOI: https://doi.org/10.21873/anticanres.14496

Abstract

Background: Mutations in the isocitrate dehydrogenase 1 (IDH1) gene are frequently found in various cancer types. IDH1 mutants produce 2-hydroxyglutarate (2-HG), an oncometabolite, from alpha-ketoglutarate (α-KG). This 2-HG plays a key role in tumorigenesis via inhibition of α-KG dependent enzymes. For this reason, IDH1 mutant could be an ideal target for the treatment of cancer. Materials and Methods: To find a new IDH1 inhibitor, 8,364 compounds were obtained from Korea Chemical Bank. Using high-throughput screening (HTS) of a chemical library, we unveiled a compound that could inhibit the IDH1 mutant. Results: According to the enzyme assay, our compound (KRC-09) effectively inhibited the activity of IDH1 R132H mutant. In addition, KRC-09 decreased the concentration of intracellular 2-HG in the U-87 MG cell line harboring IDH1 R132H. Conclusion: In this article, we present a novel chemical scaffold that suppresses the activity of an IDH1 mutant.

Since the first detection of isocitrate dehydrogenase 1 (IDH1) mutant in glioblastoma tumor samples in 2008 (1), it has been identified in other cancers as well, including low grade (WHO grade II, III) gliomas, secondary glioblastomas (2-4), acute myeloid leukemias (5, 6), and sarcomas (7, 8). IDH is a metabolic enzyme that is responsible for the oxidative decarboxylation of isocitrate to α-KG. All three isoforms of IDH (IDH1, IDH2 and IDH3) are expressed in eukaryotic cells (9). IDH1 and IDH2 are homodimeric enzymes that utilize nicotinamide adenine dinucleotide phosphate (NADP+) as a co-factor for the metabolic reaction. In contrast, IDH3 is a heterotetrameric enzyme that uses nicotinamide adenine dinucleotide (NAD+) as a reaction substrate. Continuing along this line, IDH1 produces α-KG and NADPH through its chemical reaction. The α-KG activates a variety of α-KG dependent dioxygenases and functions as a key intermediate product in the Krebs cycle. NAPDH also plays an important role in oxidative damage and lipid biosynthesis in the cell. So far, all IDH1 mutations were tracked to an arginine residue at codon 132; this arginine could be mutated to a histidine, cysteine, serine, glycine, or lysine. More specifically, in glioblastoma, 90% of the amino acid conversions result in histidine, which gives rise to the IDH1 R132H mutant (10). This IDH1 mutant has a new enzymatic function that catalyzes the conversion of α-KG to the (R)-enantiomer of 2-HG (R-2-HG) (11, 12). As such, the mutant increases the amount of intracellular 2-HG, a known oncometabolite. Because 2-HG is structurally very similar to α-KG, it competitively inhibits the activity of α-KG-dependent dioxygenases. Notably, 2-HG inhibits one of α-KG-dependent dioxygenases, tet methylcytosine dioxygenase 2 (TET2, a DNA modifying enzyme), to induce tumorigenesis (13-15). Furthermore, inhibition of histone demethylases, which act as tumor suppressors, by 2-HG increases the risk of cancer (16-18). Based on these observations, IDH1 R132H could be a potential target for the treatment of cancer.

In this study, we performed a high throughput screen and identified a new compound which can inhibit IDH1 R132H activity. Although this compound is not as good as known inhibitors such as AGI-5198, it has a novel scaffold. Based upon this study, we hope to get potent IDH1 R132H inhibitors by performing future compound optimizations.

Materials and Methods

Protein induction and purification. We transformed the pRSFDuet-1 IDH1 R132H vector (containing a 6x histidine-tag and maltose-binding protein-tag) into E. coli BL21 (DE3). This pRSFDuet-1 IDH1 R132H vector was kindly supplied by Dr. James Downing, St. Jude Children's Research hospital (Memphis, TN, USA). The MBP-tag was used to improve the solubility of the recombinant protein. The transformed E. coli was grown in LB medium (50 μg/ml kanamycin, 37°C) until the culture reached a 600 nm optical density (O.D) of 0.8. To induce proteins, we added 0.6 μM of isopropyl β-D-1-thiogalactopyranoside (IPTG) (overnight, 18°C). Next, cells were harvested by centrifugation and the pellet was sonicated in lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8.0). Thereafter, the lysates were ultracentrifuged (10,000 g, 4°C, 1 h). Ni-NTA beads (QIAGEN, Venlo, the Netherlands) were mixed with the supernatant of the lysate (4°C, 2 h) and mixtures were loaded on polypropylene columns (QIAGEN, Venlo, Netherlands), followed by washing with buffer solution (50 mM NaH2PO4, 300 mM NaCl, 20 mM imidazole, pH 8.0). Finally, proteins were eluted using elution buffer (50 mM NaH2PO4, 300 mM NaCl, 250 mM imidazole, pH 8.0) and stored at −70°C. To confirm the expression of IDH1 R132H, each sample was loaded on a SDS-PAGE gel and stained with coomassie brilliant blue. The recombinant IDH1 R132H protein weight was approximately 100 kDa (IDH1 R132H=56 kDa and MBP-tag=42 kDa) (Figure 1B).

Cell line generation and culture. To generate lentivirus, we cloned the IDH1 R132H gene into a pHR plasmid. The pHR vector was digested with BamHI and EcoRI restriction enzymes. Polymerase chain reaction (PCR) of the IDH1 R132H gene was performed with the pHR-IDH1-forward primer (5’ AGCATC GGATCC ATGTCCAAAAAAATC 3’) and the pHR-IDH1-reverse primer (5’ ATCTGA GAATTC TTAAAGTTTGGCCTGAGCTAGTTT G 3’). Next, 1.6×107 293T cells were seeded onto 100 mm dishes. Following overnight incubation, a mock vector or the pHR-IDH1 R132H vector was co-transfected with the lentiviral packaging plasmids, pRSV-Rev, pMDLg/pRRE and pMD2.G (12253, 12251, 12259; Addgene, Watertown, MA, USA) into 293T cells. The following day, we renewed the medium and collected supernatant (containing the lentivirus) 24 and 48 h after co-transfection. In turn, we concentrated the supernatant using 0.45 μm polyethersulfone (PES) filter and a Lenti-X Concentrator (631232; Clontech, Mountain View, CA, USA). For transduction, lentivirus-containing supernatant, U-87 MG cells and 8 μg/ml polybrene were combined in 6-well plates. We selected cells using 5 μg/ml puromycin 72 h after transduction. The 293T and U-87 MG cell lines were cultured in Dulbecco's Modified Eagles Medium (SH30243; HyClone Laboratory Tools, Marlborough, MA, USA) supplemented with 10 % fetal bovine serum (16000-044; Gibco Life Technologies, Carlsbad, CA, USA), and grown in a humidified incubator (37°C, 5% CO2).

Enzyme assay. First, the assay buffer consisting of 150 mM NaCl, 20 mM Tris 7.5, 10 mM MgCl2 and 0.05% bovine serum albumin was added to 384-well plates. Next, the test compounds, 2 nM purified IDH1 R132H, 1 mM α-ketoglutaric acid (75892; Sigma-Aldrich, St Louis, MO, USA) and 24 μM β-nicotinamide adenine dinucleotide 2’-phosphate (N7505; Sigma-Aldrich, St Louis, MO, USA) were added to each well. Subsequently, we incubated the reaction plates (25°C, 1 h). The total reaction volume was 50 μl. To perform the second phase reaction, 10 mM resazurin (R7017; Sigma-Aldrich, St Louis, MO, USA) and 12 μg/μl diaphorase (D5540; Sigma-Aldrich, St Louis, MO, USA) were added to the initial reaction wells. Following centrifugation (1000 rpm, 30 s), we incubated the reaction plate (25°C, 30 min). The final total volume per reaction well was 75 μl. Finally, fluorescence was detected at 544 nm excitation and 590 nm emission, using an Envision 2104 (PerkinElmer, Waltham, MA, USA).

2-HG concentration measurements. 2-HG levels in U-87 MG cells were measured using liquid chromatography-mass spectrometry (LC-MS). First, mock U-87 MG and pHR-IDH1 R132H U-87 MG cells were seeded in 12-well plates, at a density of 4×105 cells/well. To extract 2-HG from cultured cells, 80% cold methanol was added, followed by centrifugation (13,000 rpm at 4°C for 10 min) and the supernatant was then transferred to a microtube. We based our LC-MS methodology on a previously published protocol (19).

Antibodies and immunoblotting. To confirm expression of IDH1, 4×105 mock U-87 MG or IDH1 R132H U-87 MG cells were seeded in 12-well plates. After overnight incubation, cells were harvested using sample buffer [10% glycerol, 2% SDS, 50 mM Tris-HCl (pH 6.8), 3% β-mercaptoethanol] and then boiled at 95°C for 10 min. Lysates were loaded into 4-15% gradient gels (Bio-Rad Laboratories, Hercules, CA, USA) and the amount of protein was measured using anti-IDH1 (8137; Cell Signaling Technology, Danvers, MA, USA) antibodies. As a loading control, we detected tubulin (MA5-16308; Invitrogen, Waltham, MA, USA).

Compound preparation. 1-(2,6-Dichlorophenyl)-4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole (KRC-09b) to a solution of 2-(1H-Imidazol-1-yl)-1-(3-methoxyphenyl)-3,3-bis(methylthio)prop-2-en-1-one (100 mg, 0.31 mmol) in EtOH (2 ml) was added 2,6-dichlorophenyl ydrazine hydrochloride (132 mg, 0.62 mmol) and triethylamine (0.04 ml, 0.62 mmol) at room temperature for 2 h. The resulting mixture was refluxed for 2 h and then solvent was removed with a rotary evaporator. The residue was purified by silica gelflash chromatography (50% EtOAC/MC) to afford 1-(2,6-Dichlorophenyl)-4-(1H-imidazol-1-yl)-5-(3-methoxyphenyl)-3-(methylthio)-1H-pyrazole (42 mg, 34%) as a yellow solid; 1H NMR (300 MHz, CDCl3) δ 7.54 (s, 1H), 7.40 (d, J=3Hz, 1H), 7.38 (s, 1H), 7.31 (d,d, J=6.48 Hz, 2.88 Hz,), 7.14 (d, J=3.24 Hz, 1H), 7.10 (d, J=7.95 Hz, 1H), 7.04 (s, 1H), 6.80 (d,d, J=8.46 Hz, 2.58 Hz), 6.63 (d, J=7.71 Hz, 1H), 6.56 (t, J=1.95 Hz, 1H) 3.59 (s, 3H), 2.53 (s, 3H) 1-(2,6-Dichlorophenyl)-5-(2,5-dimethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole (KRC-09h) to a solution of 2-(1H-Imidazol-1-yl)-1-(3-methoxyphenyl)-3,3-bis(methylthio)prop-2-en-1-one (70 mg, 0.20 mmol) in EtOH (3 ml) was added 2,6-dichlorophenyl ydrazine hydrochloride (85 mg, 0.40 mmol) and triethylamine (0.05 ml, 0.40 mmol) at room temperature for 2 h. The resulting mixture was refluxed for 19 h and then solvent was removed with a rotary evaporator. The residue was purified by silica gelflash chromatography (50% EtOAC/MC) to afford 1-(2,6-Dichlorophenyl)-5-(2,5-dimethoxyphenyl)-4-(1H-imidazol-1-yl)-3-(methylthio)-1H-pyrazole (70 mg, 76%) as a yellow oil; 1H NMR (300 MHz, CDCl3) δ 7.54 (s, 1H), 7.38-7.24 (m, 3H), 7.08 (s, 1H), 7.03 (t, J=1.23 Hz, 1H), 6.80 (dd, J=9.03 Hz, 3.06 Hz, 1H), 6.68 (d, J=9.03 Hz, 1H), 6.58 (d, J=3.03 Hz, 1H), 3.56 (s, 3H), 3.45 (s, 3H), 2.53 (s, 3H).

Figure 1.
Figure 1.

(A) The enzymatic function of the isocitrate dehydrogenase 1 wild type (top) and IDH1 mutant type (bottom). (B) SDS-PAGE of purified recombinant IDH1 R132H protein. (C) Results of the enzyme assay of 8,364 compounds at 100 μM. (D) Results of the enzyme assay of 959 compounds at 30 μM.

Results

Novel compounds inhibit the activity of IDH1 R132H mutant. We established an enzyme assay system to investigate the efficacy of inhibitors targeting IDH1 R132H. Wild type IDH1 catalyzes the conversion of isocitrate to α-KG (Figure 1A, top), whereas the IDH1 mutant converts α-KG to 2-HG, using NADPH as a co-factor (Figure 1A, bottom). The enzyme assay system uses the functionality of the IDH1 mutant and is comprised of two reaction steps. In the first step, α-KG is converted to 2-HG by IDH1 R132H. In the next step, NADPH is oxidized to NADP, and the remaining NADPH is involved in the second reation step. In this second step, resazurin is converted to fluorescent resorufin, which uses the remaining NADPH. Therefore, if the compound effectively inhibits IDH1 R132H, noticeable fluorescence will be observed. In order to identify potent IDH1 R132H inhibitors, 8,364 compounds were collected from the Korea Chemical Bank of the Korea Research Institute of Chemical Technology (KRICT). The compounds were used at a concentration of 100 μM and their inhibitory abilities against IDH1 R132H were assessed (Figure 1C). AGI-5198, an effective inhibitor of IDH1 R132H, was used as a reference compound. Based on the experimental results of all 8,364 test compounds, we selected 959 compounds that inhibited the activity of IDH1 R132H by more than 35%. Next, from the 959 compounds mentioned above, 80 compounds with a notably high inhibitory effect were selected following an additional enzyme assay at a concentration of 30 μM (Figure 1D).

Novel compounds decrease intracellular 2-HG level in a U-87 MG cell line containing IDH1 R132H. To investigate the inhibitory effect of the aforementioned 80 compounds against the activity of intracellular IDH1 R132H, we generated stable IDH1 R132H cell lines. A mock vector or IDH1 R132H were transduced into U-87 MG glioblastoma cancer cells. Following puromycin selection, we confirmed the expression of IDH1 protein via western blotting (Figure 2A). To assess the intracellular 2-HG levels, we collected culture medium of the mock U-87 MG and IDH1 R132H U-87 MG cell lines. The concentration of 2-HG was measured using liquid chromatography-electrospray ionization-mass spectrometry (LC-MS) (Figure 2B). As expected, the concentration of 2-HG in mock U-87 MG cells was very low. In contrast, the 2-HG level in IDH1 R132H U-87 MG cells was significantly increased. As was previously reported, it is clear that this IDH1 mutation increased the production of intracellular 2-HG.

Figure 2.
Figure 2.

(A) The expression of isocitrate dehydrogenase 1 mutant in mock U-87 MG and IDH1 R132H U-87 MG cells. (B) The intracellular 2-HG concentration of mock U-87 MG and IDH1 R132H U-87 MG cells. (C) Ability of 2-HG inhibition of 80 compounds in IDH1 R132H U-87 MG cells.

IDH1 R132H U-87 MG cells were then treated with the 80 compounds. As with the enzyme assay, we used AGI-5198 as a reference compound. IDH1 R132H U-87 MG cells were seeded in 12-well plates and treated with 25 μM not shownng a methoxy functional group in Ra portion effectively suppressed ection. of the test compound. After overnight incubation, samples were collected and 2-HG levels were measured (Figure 2C). Of the 80 compounds, we selected 9 chemicals as hit compounds which effectively inhibited 2-HG production (Figure 3). These compounds inhibited the production of 2-HG by more than 15%. In order to determine a single candidate among the 9 compounds, the 2-HG production inhibitory ability was measured at three concentrations of 12.5 μM, 25 μM or 50 μM. In addition, IC50 values of the compounds were measured by enzyme assay. Table I shows the enzyme assay and 2-HG assay results of AGI-5198 and 9 compounds. KRC-09 effectively inhibited the activity of IDH1 R132H, and decreased intracellular 2-HG in a concentration-dependent manner. In order to find a more effective compound, derivatives of KRC-09 were collected from the chemical library of the Korea Chemical Bank. Inhibitory effects of derivatives were measured using an enzyme assay and a 2-HG assay (Table II). As a result, most of the derivatives of KRC-09 showed potent inhibition against IDH1 R132H. Because the compounds we used were from a chemical library, we re-synthesized several compounds (KRC-09b, KRC-09h) and measured the enzymatic activity to confirm that the chemical structure is correct. We described the synthesis procedure in Materials and Methods. These re-synthesized compounds showed similar inhibitory activity to the compounds in the chemical library. The IC50 of re-synthesized KRC-09b and re-synthesized KRC-09h is 7.5 μM and 11 μM, respectively. Therefore, we established that this scaffold is effective against IDH1 R132H. Interestingly, compounds with a fluoro group in Ra position (KRC-09c, KRC-09i and KRC-09m) did not suppress the production of the intracellular 2-HG by IDH1 R132H, although they showed potent activity in the enzyme assay (Table II). In contrast, compounds having a methoxy functional group in Ra position effectively suppressed 2-HG production as well as enzymatic activity of IDH1 R132H. Based upon these data, we suggest a new scaffold for inhibition against IDH1 R132H.

Figure 3.
Figure 3.

Chemical scaffolds of KRC compounds.

Discussion

IDH1 mutants induce tumorigenesis via the production of 2-HG metabolites in various cancer types. In glioblastoma, IDH1 R132H accounts for more than 90 % of the IDH1 mutant forms. We have collected various compounds from the chemical library of the Korea Chemical Bank to identify a potent inhibitor of IDH1 R132H. To this end, we used an enzyme and 2-HG assay. Following several selection rounds, we identified a novel compound (KRC-09) that inhibited the activity of IDH1 R132H. To further specify which compounds were most effective, we also studied the derivatives of KRC-09. In the enzyme assay, most of the derivatives showed inhibitory effects against the IDH1 mutant. Out of these derivatives, derivatives with methoxy functional group in Ra position effectively suppressed the activity of IDH1 R132H in both the enzyme assay and 2-HG assay. In this study, we found that the imidazolyl-diphenyl pyrazole scaffold is effective at inhibiting IDH1 R132H. To discover potent IDH1 R132H inhibitors, we can introduce various functional groups, such as methoxy, hydroxyl, or alkyl groups, on phenyl groups. Alternatively, we can try to change imidazoles or pyrazoles to other 5- or 6-membered rings. By doing this, we hope to get potent IDH1 R132H inhibitors in the future.

View this table:
Table I.

Biological activity of AGI-5198 and KRC compounds.

View this table:
Table II.

Functional groups and biological activity of KRC-09 derivatives.

Acknowledgements

The chemical library used in this study was kindly provided by Korea Chemical Bank (http://www.chembank.org/) of Korea Research Institute of Chemical Technology. This research was supported by Korea Research Institute of Chemical Technology (SI1806).

Footnotes

  • Authors' Contributions

    CHK, SA and CHP conceptualized and designed the study and interpreted the results. CHK, YHS, HKL and SA performed the experiments, and analyzed data. CSY synthesized the compounds. CHK and CHP wrote the manuscript. SUC and HGJ provided conceptual and technical support. All Authors listed have approved the work for publication.

  • Conflicts of Interest

    All Authors declare no conflicts of interest.

  • Received June 24, 2020.
  • Revision received July 15, 2020.
  • Accepted July 17, 2020.

References

  1. ↵
    1. Cancer Genome Atlas Research Network
    : Comprehensive genomic characterization defines human glioblastoma genes and core pathways. Nature 455(7216): 1061-1068, 2008. PMID: 18772890. DOI: 10.1038/nature07385
    OpenUrlCrossRefPubMed
  2. ↵
    1. Balss J,
    2. Meyer J,
    3. Mueller W,
    4. Korshunov A,
    5. Hartmann C,
    6. von Deimling A
    : Analysis of the idh1 codon 132 mutation in brain tumors. Acta Neuropathol 116(6): 597-602, 2008. PMID: 18985363. DOI: 10.1007/s00401-008-0455-2
    OpenUrlCrossRefPubMed
    1. Watanabe T,
    2. Nobusawa S,
    3. Kleihues P,
    4. Ohgaki H
    : Idh1 mutations are early events in the development of astrocytomas and oligodendrogliomas. Am J Pathol 174(4): 1149-1153, 2009. PMID: 19246647. DOI: 10.2353/ajpath.2009.080958
    OpenUrlCrossRefPubMed
  4. ↵
    1. Yan H,
    2. Parsons DW,
    3. Jin G,
    4. McLendon R,
    5. Rasheed BA,
    6. Yuan W,
    7. Kos I,
    8. Batinic-Haberle I,
    9. Jones S,
    10. Riggins GJ,
    11. Friedman H,
    12. Friedman A,
    13. Reardon D,
    14. Herndon J,
    15. Kinzler KW,
    16. Velculescu VE,
    17. Vogelstein B,
    18. Bigner DD
    : Idh1 and idh2 mutations in gliomas. N Engl J Med 360(8): 765-773, 2009. PMID: 19228619. DOI: 10.1056/NEJMoa0808710
    OpenUrlCrossRefPubMed
  5. ↵
    1. Paschka P,
    2. Schlenk RF,
    3. Gaidzik VI,
    4. Habdank M,
    5. Kronke J,
    6. Bullinger L,
    7. Spath D,
    8. Kayser S,
    9. Zucknick M,
    10. Gotze K,
    11. Horst HA,
    12. Germing U,
    13. Dohner H,
    14. Dohner K
    : Idh1 and idh2 mutations are frequent genetic alterations in acute myeloid leukemia and confer adverse prognosis in cytogenetically normal acute myeloid leukemia with npm1 mutation without flt3 internal tandem duplication. J Clin Oncol 28(22): 3636-3643, 2010. PMID: 20567020. DOI: 10.1200/JCO.2010.28.3762
    OpenUrlAbstract/FREE Full Text
  6. ↵
    1. Mardis ER,
    2. Ding L,
    3. Dooling DJ,
    4. Larson DE,
    5. McLellan MD,
    6. Chen K,
    7. Koboldt DC,
    8. Fulton RS,
    9. Delehaunty KD,
    10. McGrath SD,
    11. Fulton LA,
    12. Locke DP,
    13. Magrini VJ,
    14. Abbott RM,
    15. Vickery TL,
    16. Reed JS,
    17. Robinson JS,
    18. Wylie T,
    19. Smith SM,
    20. Carmichael L,
    21. Eldred JM,
    22. Harris CC,
    23. Walker J,
    24. Peck JB,
    25. Du F,
    26. Dukes AF,
    27. Sanderson GE,
    28. Brummett AM,
    29. Clark E,
    30. McMichael JF,
    31. Meyer RJ,
    32. Schindler JK,
    33. Pohl CS,
    34. Wallis JW,
    35. Shi X,
    36. Lin L,
    37. Schmidt H,
    38. Tang Y,
    39. Haipek C,
    40. Wiechert ME,
    41. Ivy JV,
    42. Kalicki J,
    43. Elliott G,
    44. Ries RE,
    45. Payton JE,
    46. Westervelt P,
    47. Tomasson MH,
    48. Watson MA,
    49. Baty J,
    50. Heath S,
    51. Shannon WD,
    52. Nagarajan R,
    53. Link DC,
    54. Walter MJ,
    55. Graubert TA,
    56. DiPersio JF,
    57. Wilson RK,
    58. Ley TJ
    : Recurring mutations found by sequencing an acute myeloid leukemia genome. N Engl J Med 361(11): 1058-1066, 2009. PMID: 19657110. DOI: 10.1056/NEJMoa0903840
    OpenUrlCrossRefPubMed
  7. ↵
    1. Amary MF,
    2. Bacsi K,
    3. Maggiani F,
    4. Damato S,
    5. Halai D,
    6. Berisha F,
    7. Pollock R,
    8. O'Donnell P,
    9. Grigoriadis A,
    10. Diss T,
    11. Eskandarpour M,
    12. Presneau N,
    13. Hogendoorn PC,
    14. Futreal A,
    15. Tirabosco R,
    16. Flanagan AM
    : Idh1 and idh2 mutations are frequent events in central chondrosarcoma and central and periosteal chondromas but not in other mesenchymal tumours. J Pathol 224(3): 334-343, 2011. PMID: 21598255. DOI: 10.1002/path.2913
    OpenUrlCrossRefPubMed
  8. ↵
    1. Borger DR,
    2. Tanabe KK,
    3. Fan KC,
    4. Lopez HU,
    5. Fantin VR,
    6. Straley KS,
    7. Schenkein DP,
    8. Hezel AF,
    9. Ancukiewicz M,
    10. Liebman HM,
    11. Kwak EL,
    12. Clark JW,
    13. Ryan DP,
    14. Deshpande V,
    15. Dias-Santagata D,
    16. Ellisen LW,
    17. Zhu AX,
    18. Iafrate AJ
    : Frequent mutation of isocitrate dehydrogenase (idh)1 and idh2 in cholangiocarcinoma identified through broad-based tumor genotyping. Oncologist 17(1): 72-79, 2012. PMID: 22180306. DOI: 10.1634/theoncologist.2011-0386
    OpenUrlAbstract/FREE Full Text
  9. ↵
    1. Dalziel K
    : Isocitrate dehydrogenase and related oxidative decarboxylases. FEBS Lett 117 Suppl: K45-55, 1980. PMID: 6774891. DOI: 10.1016/0014-5793(80)80569-2
    OpenUrlCrossRefPubMed
  10. ↵
    1. Ohba S,
    2. Hirose Y
    : Biological significance of mutant isocitrate dehydrogenase 1 and 2 in gliomagenesis. Neurol Med Chir (Tokyo) 56(4): 170-179, 2016. PMID: 26960449. DOI: 10.2176/nmc.ra.2015-0322
    OpenUrl
  11. ↵
    1. Dang L,
    2. White DW,
    3. Gross S,
    4. Bennett BD,
    5. Bittinger MA,
    6. Driggers EM,
    7. Fantin VR,
    8. Jang HG,
    9. Jin S,
    10. Keenan MC,
    11. Marks KM,
    12. Prins RM,
    13. Ward PS,
    14. Yen KE,
    15. Liau LM,
    16. Rabinowitz JD,
    17. Cantley LC,
    18. Thompson CB,
    19. Vander Heiden MG,
    20. Su SM
    : Cancer-associated idh1 mutations produce 2-hydroxyglutarate. Nature 465(7300): 966, 2010. PMID: 19935646. DOI: 10.1038/nature09132
    OpenUrlCrossRefPubMed
  12. ↵
    1. Figueroa ME,
    2. Abdel-Wahab O,
    3. Lu C,
    4. Ward PS,
    5. Patel J,
    6. Shih A,
    7. Li Y,
    8. Bhagwat N,
    9. Vasanthakumar A,
    10. Fernandez HF,
    11. Tallman MS,
    12. Sun Z,
    13. Wolniak K,
    14. Peeters JK,
    15. Liu W,
    16. Choe SE,
    17. Fantin VR,
    18. Paietta E,
    19. Lowenberg B,
    20. Licht JD,
    21. Godley LA,
    22. Delwel R,
    23. Valk PJ,
    24. Thompson CB,
    25. Levine RL,
    26. Melnick A
    : Leukemic idh1 and idh2 mutations result in a hypermethylation phenotype, disrupt tet2 function, and impair hematopoietic differentiation. Cancer Cell 18(6): 553-567, 2010. PMID: 21130701. DOI: 10.1016/j.ccr.2010.11.015
    OpenUrlCrossRefPubMed
  13. ↵
    1. Suzuki H,
    2. Yamamoto E,
    3. Maruyama R,
    4. Niinuma T,
    5. Kai M
    : Biological significance of the cpg island methylator phenotype. Biochem Biophys Res Commun 455(1-2): 35-42, 2014. PMID: 25016183. DOI: 10.1016/j.bbrc.2014.07.007
    OpenUrlCrossRefPubMed
    1. Dimitrov L,
    2. Hong CS,
    3. Yang C,
    4. Zhuang Z,
    5. Heiss JD
    : New developments in the pathogenesis and therapeutic targeting of the idh1 mutation in glioma. Int J Med Sci 12(3): 201-213, 2015. PMID: 25678837. DOI: 10.7150/ijms.11047
    OpenUrlCrossRefPubMed
  15. ↵
    1. Tahiliani M,
    2. Koh KP,
    3. Shen Y,
    4. Pastor WA,
    5. Bandukwala H,
    6. Brudno Y,
    7. Agarwal S,
    8. Iyer LM,
    9. Liu DR,
    10. Aravind L,
    11. Rao A
    : Conversion of 5-methylcytosine to 5-hydroxymethylcytosine in mammalian DNA by mll partner tet1. Science 324(5929): 930-935, 2009. PMID: 19372391. DOI: 10.1126/science.1170116
    OpenUrlAbstract/FREE Full Text
  16. ↵
    1. Dalgliesh GL,
    2. Furge K,
    3. Greenman C,
    4. Chen L,
    5. Bignell G,
    6. Butler A,
    7. Davies H,
    8. Edkins S,
    9. Hardy C,
    10. Latimer C,
    11. Teague J,
    12. Andrews J,
    13. Barthorpe S,
    14. Beare D,
    15. Buck G,
    16. Campbell PJ,
    17. Forbes S,
    18. Jia M,
    19. Jones D,
    20. Knott H,
    21. Kok CY,
    22. Lau KW,
    23. Leroy C,
    24. Lin ML,
    25. McBride DJ,
    26. Maddison M,
    27. Maguire S,
    28. McLay K,
    29. Menzies A,
    30. Mironenko T,
    31. Mulderrig L,
    32. Mudie L,
    33. O'Meara S,
    34. Pleasance E,
    35. Rajasingham A,
    36. Shepherd R,
    37. Smith R,
    38. Stebbings L,
    39. Stephens P,
    40. Tang G,
    41. Tarpey PS,
    42. Turrell K,
    43. Dykema KJ,
    44. Khoo SK,
    45. Petillo D,
    46. Wondergem B,
    47. Anema J,
    48. Kahnoski RJ,
    49. Teh BT,
    50. Stratton MR,
    51. Futreal PA
    : Systematic sequencing of renal carcinoma reveals inactivation of histone modifying genes. Nature 463(7279): 360-363, 2010. PMID: 20054297. DOI: 10.1038/nature08672
    OpenUrlCrossRefPubMed
    1. Chowdhury R,
    2. Yeoh KK,
    3. Tian YM,
    4. Hillringhaus L,
    5. Bagg EA,
    6. Rose NR,
    7. Leung IK,
    8. Li XS,
    9. Woon EC,
    10. Yang M,
    11. McDonough MA,
    12. King ON,
    13. Clifton IJ,
    14. Klose RJ,
    15. Claridge TD,
    16. Ratcliffe PJ,
    17. Schofield CJ,
    18. Kawamura A
    : The oncometabolite 2-hydroxyglutarate inhibits histone lysine demethylases. EMBO Rep 12(5): 463-469, 2011. PMID: 21460794. DOI: 10.1038/embor.2011.43
    OpenUrlAbstract/FREE Full Text
  18. ↵
    1. Lu C,
    2. Ward PS,
    3. Kapoor GS,
    4. Rohle D,
    5. Turcan S,
    6. Abdel-Wahab O,
    7. Edwards CR,
    8. Khanin R,
    9. Figueroa ME,
    10. Melnick A,
    11. Wellen KE,
    12. O'Rourke DM,
    13. Berger SL,
    14. Chan TA,
    15. Levine RL,
    16. Mellinghoff IK,
    17. Thompson CB
    : Idh mutation impairs histone demethylation and results in a block to cell differentiation. Nature 483(7390): 474-478, 2012. PMID: 22343901. DOI: 10.1038/nature10860
    OpenUrlCrossRefPubMed
  19. ↵
    1. Jaitz L,
    2. Mueller B,
    3. Koellensperger G,
    4. Huber D,
    5. Oburger E,
    6. Puschenreiter M,
    7. Hann S
    : Lc-ms analysis of low molecular weight organic acids derived from root exudation. Anal Bioanal Chem 400(8): 2587-2596, 2011. PMID: 20711769. DOI: 10.1007/s00216-010-4090-0
    OpenUrlCrossRefPubMed
Back to top

In this issue

Print
Download PDF
Article Alerts
Email Article
Citation Tools
Reprints and Permissions
Discovery of a Novel Chemical Scaffold Against Mutant Isocitrate Dehydrogenase 1 (IDH1)
CHUNG HYO KANG, SANG UN CHOI, YOU HWA SON, HEUNG KYOUNG LEE, HYE GWANG JEONG, CHANG-SOO YUN, SUNJOO AHN, CHI HOON PARK
Anticancer Research Sep 2020, 40 (9) 4929-4935; DOI: 10.21873/anticanres.14496
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo

Jump to section

Keywords