Research ArticleExperimental Studies

The Biological Role of the Long Non-coding RNA LINK-A in Ovarian Carcinoma

NATALIE FILIPPOV-LEVY, BEN DAVIDSON and REUVEN REICH
Anticancer Research December 2020, 40 (12) 6677-6684; DOI: https://doi.org/10.21873/anticanres.14691

Abstract

Aim: To analyze the biological role of the long non-coding RNA LINK-A. Materials and Methods: An 850-bp segment from the second exon of LINK-A was removed using the CRISPR/Cas9 system in OVCA433 ovarian serous carcinoma cells. Spheroid formation, migration, invasion, proliferation, matrix metalloproteinase (MMP) activity and expression of cell-signaling proteins were assessed in vitro. Results: OVCA433 cells with LINK-A deletion were more invasive (p=0.0008) but had reduced migration and MMP9 secretion compared to controls (p=0.003 and p=0.005, respectively). LINK-A deletion did not affect proliferation but induced phosphorylation of extracellular signal-regulated kinase (10-fold; p=0.005). LINK-A knock out additionally reduced spheroid formation. Conclusion: Added to our previous data from analysis of clinical specimens, LINK-A is likely to be a tumor suppressor.

Ovarian cancer (OC) is the most aggressive gynecological cancer. OC was predicted to be diagnosed in 22,530 women and lead to 13,980 fatalities in the U.S. in 2019 (1). Globally, OC was diagnosed in 295,414 women and led to 184,799 deaths in 2018, making it the eighth most common and most lethal cancer in women (2). Late diagnosis and chemotherapy resistance are two major factors contributing to the fact that prognosis remains dismal for the majority of patients (3).

Recent years have brought growing interest in non-coding RNA. Long non-coding RNAs (lncRNAs) are longer than 200 nucleotides and are involved in many different cellular processes and pathways. In cancer, lncRNAs have been found to be involved in post-transcriptional modifications and decoy of mRNA, proliferation and immortality, maintenance of genomic stability, invasion and metastasis, and drug resistance (4). LINK-A (LINC01139; also known as LOC339535 and NR_015407) is a ~1.5-kb intergenic noncoding RNA located on chromosome 1 at the 238,480,372-238,486,05 site on the antisense strand. It consists of two exons, of which the second contains functional sites consisting of a phosphatidylcholine-binding site, breast tumor kinase (BRK)-binding sites #1 and #2, a phosphatidylinositol-3,4,5-trisphosphate-binding loop and a leucine-rich repeat kinase 2 binding site. This lncRNA was first described in triple-negative breast cancer, where it was shown to phosphorylate and stabilize hypoxia-inducible factor 1α (HIF1α), and thereby promote tumorigenesis (5). In a subsequent study by the same group, LINK-A was shown to hyperactivate protein kinase B (AKT) and mediate resistance to AKT inhibitors (6). The ability of LINK-A to activate HIF1α was also subsequently demonstrated in OC (7). In OC, LINK-A was further found to activate the transforming growth factor-β pathway and to promote migration and invasion (8).

High-grade serous carcinoma (HGSC) is the most common histotype of OC, and is responsible for the majority of deaths from this disease. In a recent study of clinical HGSC specimens, we compared LINK-A expression at different anatomic sites affected by HGSC. LINK-A was overexpressed in solid metastases from the abdominal cavity compared to HGSC effusions (malignant ascites and pleural effusions), the ovarian tumors and extracellular material (exosomes) derived from HGSC effusion supernatants, suggesting upregulation during tumor progression. Conversely, higher LINK-A levels in post-chemotherapy HGSC effusions were significantly related to longer progression-free and overall survival, the latter finding being retained as independent prognosticator in multivariate Cox analysis, suggesting that LINK-A may have a tumor suppressor role (9). Given this apparent discrepancy, we wished to study the biological role of this molecule in OC. In the present study, we used clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology to knock out LINK-A and study the effect of this change in vitro in OC cells.

Materials and Methods

Cell culture. OC cell lines included in this study were OVCAR-3 (HGSC), OVCAR-8 (HGSC), OVCA433 (serous adenocarcinoma), OC-238 (serous cystadenocarcinoma), OVCA 429 (cystadenocarcinoma), DOV13 (adenocarcinoma) and ES-2 (clear-cell carcinoma). OVCA433, OVCA429 and DOV13 cells were a kind gift from Professor Robert Bast, MD Anderson Cancer Center, Houston TX, USA. The remaining cell lines were purchased from the American Tissue Culture Collection (Manassas VA, USA).

Cell lines were cultured at 37°C with 5% CO2 in the following media: OVCAR-3, OC-238 and ES-2: Dulbecco’s modified Eagle’s medium-high glucose (Sigma-Aldrich, St. Louis, MO, USA) with 10% fetal calf serum (FCS; Sigma-Aldrich); OVCA433, OVCA429 and DOV13: MEM-EAGLA Earle’s Salts Base (MEM; Biological Industries, Kibbutz Beit-Haemek, Israel) with 10% FCS; OVCAR-8: RPMI medium 1640 (GIBCO, Thermo Fisher Scientific, Waltham, MA, USA) with 5% FCS.

All media were supplemented with 1% MEM-Eagle non-essential amino acid solution, 1% L-glutamine solution, 1% MEM vitamin solution, 1% sodium pyruvate solution, 1% penicillin-streptomycin-amphotericin B Solution (Biological Industries).

CRISPR/Cas9 knock out. LINK-A active sites are found on the second exon, and we therefore decided to delete it. To achieve this goal, we designed two guides that cut out ~870 bases of the second exon. The guides were designed with the help of Massachusetts Institute of Technology (https://zlab.bio/guide-design-resources) and University of California, Santa Cruz (http://genome.ucsc.edu/index.html) web sites. Each guide was cloned into a PX330 plasmid (pX330-U6-Chimeric_BB-CBh-hSpCas9; a kind gift from Dr. Yosef Buganim, The Hebrew University of Jerusalem, Israel).

PX330 plasmid transfection into OVCA433 cells was performed using Avalanche-Everyday (EZ Biosystems, College Park, MD, USA) with 1.25 μg of each guide plasmid and 0.5 μg of puromycin-resistant plasmid (Fuw-original-puro-2A-EGFP was a kind gift from Dr. Yosef Buganim) co-transfected for 24 hours, followed by puromycin selection for another 48 hours. The transfected cells were then seeded as single cells in a 96-well plate.

Spheroid formation. Control and knock out OVCA433 cells (n=400,000) were seeded on a 6-well plate dish and agitated at 20 rpm for 24 hours, then photographed. The medium was collected for RNA isolation.

Scratch assay/migration assay. OVCA433 cells (n=100-200,000) were seeded on a 12-well plate dish and cultured to confluence. A scratch was made with a 1 ml pipette tip and images were taken at 0, 6 and 24 hours. Results were analyzed using the ImageJ program (NIH, Bethesda, MD, USA).

Cell-proliferation assay. OVCA433 cells (n=100,000) were seeded on a 12-well plate. At 0 and 24 hours, the cells were treated with 2 mg/ml of 3-(4,5-dimethylthiazole-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Calbiochem, San Diego, CA, USA) for 20 minutes at 37°C in an incubator with 5% CO2. Cells were subsequently lysed using 150 μl dimethyl sulfoxide (Sigma-Aldrich) and absorption at 570 nm was then measured by a Cytation 3 instrument (BioTek Instruments, Inc., Winooski, VT, USA).

Matrigel invasion assay and motility assay. Nuclepore polycarbonate filters (13 mm, 8 μm pore size, polyvinylpyrrolidone-free; Whatman International Ltd, Maidstone, UK) were coated with extract of basement membrane components (Matrigel, 25 μg per filter) for the chemo-invasion assay or with 5 μg collagen IV for the motility assay, and placed in Boyden chambers. OVCA433 cells (n=200,000) were resuspended in serum-free medium and placed in the upper compartment of the Boyden chambers. As chemoattractant, fibroblast-conditioned medium (obtained from NIH-3T3 cells) was used. After 5 or 24 hours of incubation at 37°C in an incubator with 5% CO2, the lower surface of each filter was stained in DiffQuik (Medion Diagnostics International Inc., Miami, FL, USA) and the number of cells that invaded was counted in five random fields.

Matrix metalloproteinase (MMP) activity assay (zymography). The assay was performed on medium collected from Boyden chambers at the end of the Matrigel invasion experiment. Medium from OVCA433 control and knock out cells was loaded onto 10% sodium-dodecylsulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) gels with 1 mg/ml gelatin (Sigma-Aldrich), as previously described (10).

RNA extraction and cDNA generation. RNA was extracted from OVCA433 cells using Bio-Tri reagent (Bio-Lab Ltd, Jerusalem, Israel) according to the manufacturer’s protocol. RNA concentration was measured by a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific).

Prior to cDNA formation, 1 μg of extracted RNA was subjected to DNA degradation by PerfeCTa DNase I (Quanta Biosciences, Gaithersburg, MD, USA). cDNA was created by qScript cDNA synthesis kit (Quanta Biosciences).

Quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR) and RT-PCR. qRT-PRC was performed using the Fast SYBRTM Green Master Mix (Applied Biosystems by Thermo Fisher Scientific, Foster City, CA, USA) with specific primers in CFX Connect Real-Time system (Bio-Rad Laboratories, Hercules, CA). RT-PCR was carried out using Hy-Taq Ready Mix (2X) (Hylabs, Rehovot, Israel) with specific primers in PCR TOUCH T960 (Hangzhou Jingle Scientific Instrument Co., Ltd, Hangzhou, China). PCR products were loaded onto 1.5% agarose gel with 100-bp DNA ladder (GeneDireX Inc., Taoyuan, Taiwan, ROC). Gene expression was normalized to that for ribosomal protein lateral stalk subunit P0 (RPLP0).

Primer sequences were as follows: LINK-A: Forward: AACCAGTCAC CCAACCAGAG, reverse: CACAGGCCAGATGGAGTTTT; RPLP0: forward: CCAACTACTTCCTTAAGATCATCCAACTA, reverse: ACATGCGGATCTGCTGCA.

Western blot. Total protein isolation was performed using RIPA (1% NP-40, 20 mM Tris-HCl (pH 7.5), 137 mM NaCl, 0.5 mM EDTA, 10% glycerol, 1% protease inhibitor cocktail (Millipore, Burlington, MA, USA), 1 mM sodium orthovanadate and 0.1% sodium dodecyl sulfate (SDS). Twenty-five micrograms of protein was loaded onto 10% SDS-PAGE gel. The proteins were then transferred to Immobilon polyvinylidene difluoride membrane (Millipore). Subsequently, the membrane was blocked by 5% Difco skim milk (BD Biosciences, San Jose, CA, USA) for 1 hour, and then incubated for 16 hours at 4°C with one of the following rabbit monoclonal antibodies (all from Cell Signaling Biotechnology, Danvers, MA, USA): glyceraldehyde 3-phosphate dehydrogenase , clone 14C10; p44/42 mitogen-activated protein kinase (MAPK) (ERK1/2), clone 137F5; p-p44/42 MAPK (ERK1/2) (Thr202/Tyr204), clone 197G2.

Statistical analysis. Student’s t-test was applied.

Results

LINK-A expression in OC cell lines. LINK-A expression was analyzed in seven OC cell lines, namely OVCAR-3, OVCAR-8, OC-238, OVCA429, OVCA433, DOV13 and ES2, and in two forms of culture: 2D monolayer and 3D spheroids. LINK-A was expressed in the OVCA433, DOV13 and ES2 cell lines. In OVCA433 cells, expression was low in 2D monolayer and high in spheroids (p<0.0001; Figure 1).

Figure 1.
Figure 1.

Expression of long non-coding RNA LINK-A in the OVCA433 cell line cultured as monolayer and spheroids. *Significantly different from the control at p<0.0001. Data are the means of triplicate experiments. Error bars represent the standard deviation.

LINK-A CRISPR/Cas9 knock out. We performed knock out of the second exon of LINK-A using the CRISPR/Ca9 system in OVCA433 cells. Figure 2 shows the change in LINK-A secondary structure following knock out.

Figure 2.
Figure 2.

The secondary structure of long non-coding RNA LINK-A before (A) and after (B) the deletion of exon 2, predicted using the RNAfold web server website (http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi). The phosphatidylcholine (PC)-binding site is at nucleotides 241-300; breast tumor kinase (BRK)-binding site #1 at nucleotides 471-550, and binding site #2 at nucleotides 771-850; phosphatidylinositol-3,4,5-trisphosphate (PIP3)-binding loop at nucleotides 1081-1140; and leucine-rich repeat kinase 2 (LRRK2)-binding site at nucleotides 1251-1330.

LINK-A knock out affects invasion and migration. The invasiveness of knock out cells was strongly up-regulated following the loss of LINK-A to 452% of the control level (p=0.0008; Figure 3A). In contrast, in wound-healing assay, knock out cells closed the gap less efficiently than did control cells, with closure at 54% vs. 70%, respectively, after 24 hours (p=0.003; Figure 3B).

Figure 3.
Figure 3.
Figure 3.
Figure 3.

A: Chart showing the percentage of non-transfected control and long non-coding RNA LINK-A knock-out (KO) OCVA433 cells that invaded through Matrigel in the invasion assay. *Significantly different at p=0.0008. B: Wound-healing assay. Upper: Images at 0 and 24 hours in OVCA433 KO and control cells. Lower: Graph showing the percentage of the gap left after 24 hours for control and KO cells. *Significantly different from the control at p=0.003. C: Matrix metalloproteinase (MMP) levels in KO cells compared to controls, showing reduction to 76% and 70% for MMP2 and MMP9, respectively. *Significantly different from the control at p=0.005. D: A graph showing the optical density (O.D.) in the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay of non-transfected control and LINK-A KO OVCA433 cells at 0 hours and after 24 hours (p>0.05).

LINK-A knock out reduces MMP secretion. We examined MMP secretion in two states: cells cultured in serum-free medium for 24 hours and cells in the invasion assay, studied at 5 hours. No MMPs were found in the medium from the nontransfected cells, whereas the medium from the invasion assay, obtained from both the OVCA433 nontransfected and knock out cells, had MMP2 and MMP9 activity. A significant difference was found only for MMP9, which was reduced to 70% in knock out cell cultures (p=0.005; Figure 3C).

LINK-A does not affect cell proliferation. To find whether LINK-A is involved in cell proliferation we performed an MTT assay for 24 hours. No significant difference was found between the numbers of control and knock out cells (p>0.05; Figure 3D).

Suppression of LINK-A leads to a change in spheroid structure and size. As LINK-A was highly expressed in spheroids, we assessed the effect of knock out on their formation. Spheroids from OVCA433 knock-out cells were much smaller and less spherical compared to those formed by nontransfected control cells (Figure 4).

Figure 4.
Figure 4.

Representative images of spheroids formed by non-transfected control (A) and long non-coding RNA LINK-A knock-out (KO) OVCA433 cells (B) after 24 hours.

LINK-A suppresses ERK1/2 phosphorylation. In OVCA433 knock-out cells, levels of ERK1/2 expression were not significantly altered but the phosphorylation was elevated about 2.5-fold (p=0.0015; Figure 5).

Figure 5.
Figure 5.

Protein level of phospho-extracellular signal-regulated kinase (p-ERK) after normalization to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) in non-transfected control and long non-coding RNA LINK-A LINK-A knock-out (KO) OVCA433 cells. *Significantly different at p=0.0015.

Discussion

Research focusing on lncRNAs is a relatively new field in molecular biology but in recent years an increasing number of studies have documented the important role of these molecules in the evolution and progression of cancer. In OC, lncRNAs have been shown to be involved in invasion, proliferation, cell-cycle regulation, apoptosis, and drug resistance (11-13). Moreover, the association between lncRNA expression and patient survival has been reported by us and others (9, 14).

In the current study, we focused on the lncRNA LINK-A. In addition to its role in breast carcinoma and OC discussed above, LINK-A was recently reported to have a biological and clinical role in other cancer types. LINK-A promotes migration, invasion and proliferation in pancreatic adenocarcinoma, apparently through up-regulation of Rho-associated protein kinase 1 (ROCK1) (15). It was similarly reported to promote migration and invasion in non-small cell lung carcinoma. In this tumor type, plasma LINK-A levels were higher in patients with metastatic disease compared to those without and healthy controls (16).

Similar results have been reported in non-epithelial cancer. Plasma LINK-A levels were higher in patients with glioma and mantle-cell lymphoma compared to healthy controls, and this molecule prevented apoptosis through up-regulation of survivin in vitro (17, 18). Promotion of migration and invasion through increased HIF1α level in vitro along with higher plasma levels compared to controls were also seen in osteosarcoma (19).

Using the CRISPR/Cas9 system, we deleted the majority of the second exon and thereby eliminated LINK-A functional sites and disrupted its secondary structure. We found that LINK-A knock out suppressed migration and MMP secretion, although it increased invasion, with no effect on proliferation. Importantly, we observed that OVCA433 knock out cells did not form spheroids. Together with the high level of LINK-A initially found in spheroids, we hypothesize that this lncRNA is critical for their formation. Additionally, LINK-A knock out increased ERK1/2 phosphorylation. A previous study showed that LINK-A can activate AKT (3) but in our knock-out cells, we found no significant change in the level of AKT or its phosphorylation (data not shown).

In summary, the present study showed that LINK-A is involved in critical cellular processes in serous OC. While LINK-A knock out has both tumor-promoting and tumor-suppressing effects in an experimental model of OC, a combination of the present findings with our earlier analysis of clinical specimens may favor its tumor-suppressor role in this type of cancer. This does not concur with the above-discussed studies of different malignant tumors nor with the recent report of Hu and co-workers, in which LINK-A was reported to negatively regulate cancer cell antigen presentation and intrinsic tumor suppression (20). This discrepancy may suggest that LINK-A has different roles in different cancer types. In clinical OC, it may promote invasion and metastasis in early-stage disease but mediate undefined tumor-suppressive activities later in the clinical course, when tumor cells are metastatic. Analysis of the role of this molecule in early-stage disease, including in primary fallopian tube lesions in HGSC, may shed light on this issue.

Footnotes

  • Authors’ Contributions

    NFL: Performed the experiments and wrote the article. BD: Participated in designing the study and co-wrote the article. RR: Designed the study, supervised the experiments and critically read the article.

  • Conflicts of Interest

    The Authors declare no conflicts of interest in regard to this study.

  • Received October 2, 2020.
  • Revision received October 13, 2020.
  • Accepted October 14, 2020.

References

  1. 1.↵
    1. Siegel RL,
    2. Miller KD and
    3. Jemal A
    : Cancer statistics, 2019. CA Cancer J Clin 69(1): 7-34, 2019. PMID: 30620402. DOI: 10.3322/caac.21551
    OpenUrlCrossRefPubMed
  2. 2.↵
    1. Bray F,
    2. Ferlay J,
    3. Soerjomataram I,
    4. Siegel RL,
    5. Torre LA and
    6. Jemal A
    : Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 68(6): 394-424, 2018. PMID: 30207593. DOI: 10.3322/caac.21492
    OpenUrlCrossRefPubMed
  3. 3.↵
    1. Lheureux S,
    2. Gourley C,
    3. Vergote I and
    4. Oza AM
    : Epithelial ovarian cancer. Lancet 393(10177): 1240-1253, 2019. PMID: 30910306. DOI: 10.1016/S0140-6736(18)32552-2
    OpenUrlCrossRefPubMed
  4. 4.↵
    1. Jarroux J,
    2. Morillon A and
    3. Pinskaya M
    : History, discovery, and classification of lncRNAs. Adv Exp Med Biol 1008: 1-46, 2017. PMID: 28815535. DOI: 10.1007/978-981-10-5203-3_1
    OpenUrlCrossRefPubMed
  5. 5.↵
    1. Lin A,
    2. Li C,
    3. Xing Z,
    4. Hu Q,
    5. Liang K,
    6. Han L,
    7. Wang C,
    8. Hawke DH,
    9. Wang S,
    10. Zhang Y,
    11. Wei Y,
    12. Ma G,
    13. Park PK,
    14. Zhou J,
    15. Zhou Y,
    16. Hu Z,
    17. Zhou Y,
    18. Marks JR,
    19. Liang H,
    20. Hung MC,
    21. Lin C and
    22. Yang L
    : The LINK-A lncRNA activates normoxic HIF1α signalling in triple-negative breast cancer. Nat Cell Biol 18(2): 213-224, 2016. PMID: 28218907. DOI: 10.1038/ncb3473
    OpenUrlCrossRefPubMed
  6. 7.↵
    1. Zhang H,
    2. Yao B,
    3. Tang S and
    4. Chen Y
    : LINK-A Long non-coding RNA (lncRNA) participates in metastasis of ovarian carcinoma and upregulates hypoxia-inducible factor 1 (HIF1α). Med Sci Monit 25: 2221–2227, 2019. PMID: 30912527. DOI: 10.12659/MSM.913609
    OpenUrlCrossRef
  7. 8.↵
    1. Ma J and
    2. Xue M
    : LINK-A lncRNA promotes migration and invasion of ovarian carcinoma cells by activating TGF-β pathway. Biosci Rep 38(5): BSR20180936, 2018. PMID: 30061183. DOI: 10.1016/j.cca.2018.12.013
    OpenUrlAbstract/FREE Full Text
  8. 12.
    1. Zhan L,
    2. Li J and
    3. Wei B
    : Long non-coding RNAs in ovarian cancer. J Exp Clin Cancer Res 37(1): 120, 2018. PMID: 29921308. DOI: 10.1186/s13046-018-0793-4
    OpenUrlCrossRef
  9. 13.↵
    1. Tripathi MK,
    2. Doxtater K,
    3. Keramatnia F,
    4. Zacheaus C,
    5. Yallapu MM,
    6. Jaggi M and
    7. Chauhan SC
    : Role of lncRNAs in ovarian cancer: Defining new biomarkers for therapeutic purposes. Drug Discov Today 23(9): 1635-1643, 2018. PMID: 29698834. DOI: 10.1016/j.drudis.2018.04.010
    OpenUrlCrossRef
  10. 14.↵
    1. Ning L,
    2. Hu YC,
    3. Wang S and
    4. Lang JH
    : Altered long noncoding RNAs and survival outcomes in ovarian cancer: A systematic review and meta-analysis (PRISMA Compliant). Medicine 97(32): e11481, 2018. PMID: 30095613. DOI: 10.1097/MD.0000000000011481
    OpenUrlCrossRef
  11. 15.↵
    1. Zhang M,
    2. Wang R,
    3. Zhao X,
    4. Lu L and
    5. Wang T
    : LncRNA LINK-A regulates ROCK1 expression in early-stage pancreatic adenocarcinoma. Exp Ther Med 19(3): 1933-1939, 2020. PMID: 32104251. DOI: 10.3892/etm.2019.8400
    OpenUrlCrossRef
  12. 16.↵
    1. Liu J,
    2. Song W,
    3. Li J,
    4. Li X,
    5. Zhao R and
    6. Gong T
    : LINK-A lncRNA is up-regulated in metastatic non-small cell lung cancer and is associated with poor prognosis. Oncol Lett 18(3): 3049-3057, 2019. PMID: 31404323. DOI: 10.3892/ol.2019.10613
    OpenUrlCrossRef
  13. 17.↵
    1. Hua X,
    2. Li G,
    3. Liu Z and
    4. Niu Z
    : LINK-A lncRNA participates in the pathogenesis of glioma by interacting with survivin. Exp Ther Med 18(3): 1581-1586, 2019. PMID: 31410112. DOI: 10.3892/etm.2019.7716
    OpenUrlCrossRef
  14. 18.↵
    1. Zhao B,
    2. Liu K and
    3. Cai L
    : LINK-A lncRNA functions in the metastasis of osteosarcoma by up-regulating HIF1α. Oncol Lett 17(6): 5005-5011, 2019. PMID: 31186711. DOI: 10.3892/ol.2019.10177
    OpenUrlCrossRef
  15. 19.↵
    1. Zhang Y,
    2. Lu P,
    3. Du H and
    4. Zhang L
    : LINK-A lncRNA promotes proliferation and inhibits apoptosis of mantle cell lymphoma cell by upregulating survivin. Med Sci Monit 25: 365-370, 2019. PMID: 30636001. DOI: 10.12659/MSM.912141
    OpenUrlCrossRef
  16. 20.↵
    1. Hu Q,
    2. Ye Y,
    3. Chan LC,
    4. Li Y,
    5. Liang K,
    6. Lin A,
    7. Egranov SD,
    8. Zhang Y,
    9. Xia W,
    10. Gong J,
    11. Pan Y,
    12. Chatterjee SS,
    13. Yao J,
    14. Evans KW,
    15. Nguyen TK,
    16. Park PK,
    17. Liu J,
    18. Coarfa C,
    19. Donepudi SR,
    20. Putluri V,
    21. Putluri N,
    22. Sreekumar A,
    23. Ambati CR,
    24. Hawke DH,
    25. Marks JR,
    26. Gunaratne PH,
    27. Caudle AS,
    28. Sahin AA,
    29. Hortobagyi GN,
    30. Meric-Bernstam F,
    31. Chen L,
    32. Yu D,
    33. Hung MC,
    34. Curran MA,
    35. Han L,
    36. Lin C and
    37. Yang L
    : Oncogenic lncRNA down-regulates cancer cell antigen presentation and intrinsic tumor suppression. Nat Immunol 20(7): 835-851, 2019. PMID: 31160797. DOI: 10.1038/s41590-019-0400-7
    OpenUrlCrossRef
Back to top

In this issue

Print
Download PDF
Article Alerts
Email Article
Citation Tools
Reprints and Permissions
The Biological Role of the Long Non-coding RNA LINK-A in Ovarian Carcinoma
NATALIE FILIPPOV-LEVY, BEN DAVIDSON, REUVEN REICH
Anticancer Research Dec 2020, 40 (12) 6677-6684; DOI: 10.21873/anticanres.14691
Twitter logo Facebook logo Mendeley logo

Jump to section

Keywords