Research ArticleExperimental Studies

High Expression of UBE2B as a Poor Prognosis Factor in Patients With Rectal Cancer Following Chemoradiotherapy

WEI-LUN HUANG, CHI-WEN LUO, CHIA-LIN CHOU, CHING-CHIEH YANG, TZU-JU CHEN, CHIEN-FENG LI and MEI-REN PAN
Anticancer Research November 2020, 40 (11) 6305-6317; DOI: https://doi.org/10.21873/anticanres.14651

Abstract

Background/Aim: Neoadjuvant concurrent chemoradiotherapy (CCRT) is the standard therapeutic strategy for rectal cancer. However, 15-20% of patients undergoing neoadjuvant CCRT progress to recurrence or distant metastases. Therefore, identifying a predictive biomarker is necessary for treating CCRT. Materials and Methods: We investigated the relationship between the levels of histone ubiquitination enzyme and clinicopathological outcomes in patients with rectal cancer who were administered CCRT and confirm the role of histone ubiquitination enzyme in regulating the cell response to ionizing radiation (IR). Results: Clinical data indicated that UBE2B expression was significantly correlated with tumor regression grade. Inhibition of UBE2B elevated the genotoxicity of IR to radioresistant cell lines. In contrast, UBE2B over-expression reduced cell sensitivity to IR. Importantly, the recruitment of 53BP1 and Rad51 was remarkably prolonged in cells after pre-treatment with UBE2B inhibitor, TZ9, suggesting a defective DNA repair pathway in UBE2B-deficient cells. Conclusion: These results indicate that over-expression of UBE2B correlates with poor response and low survival rate in patients who are administered preoperative CCRT.

The incidence of colorectal cancer (CRC) has been related to the human development index (1). In 2018, approximately 704,376 rectal cancer cases were diagnosed worldwide, resulting in 310,394 deaths (2). In Taiwan, both the incidence and mortality of rectal cancer have been increasing each year, with 5,751 new rectal cancer cases and 1,687 deaths reported in 2016 (3). Generally, CRCs include both colon cancer and rectal cancer. Given the different locations of the cancer in the human body, colon cancer patients and rectal cancer patients are treated using different methods. Concurrent chemoradiotherapy (CCRT) is used as a neoadjuvant therapy for locally advanced rectal cancer showing lymph node metastases or peri-rectal extension before radical surgery, or as a definitive therapy for unresectable cases (4, 5). Nevertheless, 15-20% of patients administered neoadjuvant CCRT eventually develop local recurrence or distant metastases (6). Furthermore, the pathological complete response (pCR) rate is low, with only 4-33% of patients administered fluoropyrimidine-based CCRT achieving a pCR (7-9). Evidence suggests that patients who achieved pCR after CCRT have superior outcomes compared to those who show an incomplete pathologic response (10). Therefore, prognostic biomarkers are needed to predict the outcomes of patients administered CCRT and to improve the response to ionizing radiation (IR).

IR exerts lethal effects by causing DNA damage. Radiation-induced DNA lesions include base pair damage, single-strand breaks, and double-strand breaks (DSBs). To maintain genome integrity, cells have evolved several response systems for repairing numerous DNA lesions. Homologous recombination and non-homologous end-joining are two major approaches used to repair DSBs. Cells with a defective DNA damage response (DDR) display sensitivity to IR exposure. Therefore, investigating the detailed mechanisms of the DDR may provide important clues for clinical rectal cancer treatment.

Increasing evidence has indicated that histone ubiquitination plays an important role in modulating the interplay among DNA repair systems. For example, UBE2A and UBE2B are ubiquitin-conjugating enzymes involved in RAD18-mediated ubiquitination of H2B and proliferating cell nuclear antigen (PNCA) to bypass DNA replication-mediated single-strand breaks by activating the DNA damage tolerance of DNA polymerase (11-13). USP16, a histone H2A deubiquitinase, interacts with the ubiquitin E3 ligase HERC2 to negatively regulate DDR (14). Ubiquitin-specific protease 21 (USP21) can deubiquitinate and stabilize BRCA2, and further trigger the recruitment of Rad51 to the DNA damage site. Knockdown of USP21 decreases the cell's ability to perform HR repair, increases the levels of γH2AX, and reduces tumor cell survival (15). USP22 is one of the Spt-Ada-Gcn5-acetyltransferase (SAGA) deubiquitination modules required for the deubiquitination of histone H2B in initiating DDR. Knockdown of USP22 not only blocks the deubiquitination of H2BK120ub, but also decreases ATM- and DNAPK-induced γH2AX formation following DNA damage (16). Thus, the cellular repair process is tightly controlled and regulated by the interplay between ubiquitination and deubiquitination of histone and non-histone proteins at damaged loci. Therefore, targeting aberrant histone ubiquitination may provide a personalized strategy for predicting the response of patients to CCRT.

This study aimed to investigate the relationship between the levels of histone ubiquitination enzyme and clinicopathological outcomes in patients with rectal cancer who were administered CCRT. In vitro cell-based assays were conducted to confirm the role of histone ubiquitination enzyme in regulating the cell response to IR.

Materials and Methods

Cell culture. SW48 (ATCC, Manassas, VA, USA), HCT-116 and Caco-2 (BCRC, HsinChu, Taiwan) colon cancer cell lines were used in this study. Cells were maintained in Dulbecco's Modified Eagle's Medium containing 10% fetal bovine serum and antibiotics and incubated at 37°C in a humidified incubator in a 5% CO2 atmosphere. HCT-116-R cells are HCT-116 cells that survived exposure to 8 Gy IR.

Plasmid and antibodies. Anti-tubulin, anti-actin, anti-UBE2A, and anti-UBE2B antibodies were purchased from Genetex (San Antonio, TX, USA). Specific RNA interference expression plasmids sh-UBE2B (#1 sequence: GCATGGTGTGAACTAAGTTAT; #2 sequence: GCAGTTATATTTGGACCAGAA; #3 sequence: CGGGATTTCAAGCGGTTACAA) and shRNA directed against luciferase (sequence: CTTCGAAATGTCCGTTCGGTT) as a control shRNA were purchased from the National RNAi Core Facility (Academia Sinica, Taiwan).

UBE2B transfection. To establish the stable UBE2B-depleted HCT-116-R cells, HCT-116-R cells were transfected with media containing sh-UBE2B lentivirus particles and polybrene. After 24 h, the medium was replaced with fresh medium containing 2.5 μg/ml of puromycin to select successfully infected cells. The Myc-DDK-tagged UBE2B plasmid was purchased from OriGene (Rockville, MD, USA). TZ9, a specific inhibitor of UBE2B, was obtained from Cayman Chemical (Ann Arbor, MI, USA).

Colony formation assay. About 1×103 cells seeded in 6-cm dish were treated with 4 Gy of IR and then incubated for 14 days to allow the colony formation. Colonies were stained with Giemsa (Sigma Aldrich Co., St. Louis, MI, USA) and counted. Relative survival was defined as the number of colonies counted after IR, divided by the number of colonies without IR. The experiments were repeated at least three times.

Real-time RT-qPCR analysis. Total RNA was extracted using the RNeasy mini kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. Equal amounts of RNA were used to synthesize first-strand cDNA using the RT2 first strand kit (Qiagen). Reverse transcription (RT)-PCR was performed using SYBR Green and the Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The primers used were: UBE2A-forward, 5’-CCTCATGCGGGACTTCAAGA-3’; UBE2A-reverse, 5’-CCTGGCTGTTTGCTGGACTA-3’; UBE2B-forward, 5’-AAGCGGTTACAAGAGGACCC-3’; UBE2B-reverse, 5’-CCTGATAAAGCTGTGCTGCC -3’; RNF2-forward, 5’-TTCAGGCCTCATCCCACACT-3’; RNF2-reverse, 5’-CAGCAGCTCCGCCACTC-3’; RNF20-forward, 5’-GAACAGCGACTCAACCGACA-3’; RNF20-reverse, 5’-GGAATTCACCCGTTCTAGGACTT-3’; USP16-forward: 5’-GGACAACTGGAGTGTATGG TGT-3’, USP16-reverse: 5’-ATCTTTCTCTGGCTTTGGAGTTG-3’; USP22-reverse, 5’-AAGAAGTCCCGCAGAAGTGG-3’; GAPDH-forward, 5’-AAGGCTGGGGCTCATTTGC-3’ and GAPDH-reverse, 5’-GCTGA TGATCTTGAGGCT-3’.

Immunoblot analysis. Protein extraction and immunoblotting were performed as previously described (17). Briefly, cells were lysed and then cellular debris were removed by centrifugation. Proteins were quantified, separated on an SDS-polyacrylamide gel, transferred to nitrocellulose membranes and then immunoblotted using the indicated antibodies.

Patient eligibility and follow-up. Paraffin-embedded tissue blocks and follow-up medical records of 172 patients with rectal cancer in Chi-Mei hospital between 1998 and 2004 were retrieved (18). All patients in the study were histologically confirmed as having a rectal adenocarcinoma and no distant metastasis. None of the 172 patients had been treated with pelvic irradiation. The patients were regularly followed-up after diagnosis until death or their last appointment. This study was approved by the institutional review board of Chi Mei Medical Center (IRB10801001). All patients were pathologically diagnosed as having rectal adenocarcinoma by endoscopic or surgical biopsy.

Histopathologic evaluation. Post-CCRT surgical specimens and Posttreatment (Post-Tx) T and N stages were evaluated by two pathologists. To objectively evaluate tumor regression after neoadjuvant CCRT, we performed tumor regression grading as described by Dworak et al. (19). ‘Grade 0’ were tumors with no observed regression; ‘grade 1’ - cancer cells with severe fibrosis and/or vasculopathy; ‘grade 2’ - fibrosis with scattered cancer cells; ‘grade 3’ - only few scattered cancer cells with fibrosis background; ‘grade 4’ - no visible cancer cells.

UBE2B immunohistochemistry and scoring. Tissue sections from Pre-Tx specimens were cut from paraffin-embedded tissue blocks at 3-mm thickness and placed on precoated slides. UBE2B expression was scored by two pathologists who were blinded to the information using a multiheaded microscope to reach a consensus for each case. The percentage of tumor cells showing UBE2B immunoexpression in each specimen was classified into five groups of various expression levels from 0 to 4, denoting none, 1-24%, 25-49%, 50-74%, and 75-100% of tumor cells with moderate to strong nuclear reactivity, respectively.

Statistical analysis. The SPSS 14 software package was used for statistical analysis (SPSS, Inc., Chicago, IL, USA). Scores of 3+ or 4+ were defined as having high expression of UBE2B for statistical analysis. The correlations between UBE2B expression and clinicopathological parameters were analyzed by Chi-square test. Survival curves were analyzed by using the Kaplan–Meier method and log-rank tests were performed to evaluate prognostic differences between different groups. Cox proportional hazards model was prepared by multivariate analysis. For all analyses, two-sided tests with p<0.05 were considered as significant.

Results

Cells surviving from ionizing radiation display high levels of UBE2B. To identify novel histone ubiquitination-modifying enzymes for predicting the cell response to IR exposure, we established radio-resistant cells. The HCT-116 cell line, which is substantially more sensitive to IR in vivo (20), was used as an in vitro cell-based model. HCT-116-R cells, which survived exposure to 8 Gy IR, were evaluated. As shown in Figure 1A, HCT-116-R cells showed a radioresistant phenotype compared to parental HCT-116 cells. Next, we performed a qPCR assay to evaluate the levels of histone ubiquitination-modifying enzymes in HCT-116 and HCT116-R cells. We found that UBE2B and UBE2A expression was markedly increased in HCT-116-R cells compared to other histone ubiquitination-modifying enzymes including RNF2, RNF20, USP16, and USP22 (Figure 1B). Similarly, the levels of UBE2B protein were also increased in HCT-116-R cells (Figure 1C). These results indicate that UBE2B is involved in the development of the IR-induced radioresistant phenotype.

Depletion of UBE2B increases radiosensitivity in CRC cells. To verify the role of UBE2B in radioresistance, we performed a clonogenic cell survival assay to assess the effects of UBE2B depletion on the cellular response to IR. As shown in Figure 2A, UBE2B knockdown in HCT-116-R cells enhanced the cellular response to IR. TZ9 has been reported to be a selective UBE2B inhibitor. Consistent with UBE2B silencing in HCT-116-R cells, treatment with TZ9 enhanced the radiosensitivity of HCT-116-R cells (Figure 2B).

UBE2B is required for the recruitment of DDR proteins. Recent evidence has indicated that UBE2A/2B cooperates with RNF168 in recruiting DNA damage repair proteins, such as BRCA1 and 53BP1, to the damaged site after IR (21). Therefore, we sought to dissect the functional involvement of UBE2B in HCT-116-R. γ-H2AX is well known as a biomarker for DNA damage. As shown in Figure 3A, we found that UBE2B was inhibited in cells treated with TZ-9, and the foci of γ-H2AX were significantly increased by UBE2B inhibition, even without IR exposure. Furthermore, the impairment of UBE2B consequently prolonged γ-H2AX foci formation. These results indicated that endogenous DNA damage and impaired DNA repair characterized UBE2B-deficient cells (Figure 3A). To gain mechanistic insights into how UBE2B might regulate the radioresistant phenotype of HCT-116-R, we examined whether inhibiting UBE2B could affect the recruitment of 53BP1 and Rad51, which are required for DNA repair. Compared with control cells, the recruitment of 53BP1 and Rad51 was remarkably prolonged in cells after pre-treatment with TZ9 for 24 h, suggesting that UBE2B inhibition resulted in defective DNA repair pathway (Figure 3B).

UBE2B regulates radioresistance in CRC cells. To further verify that UBE2B regulates the radioresistant phenotype, we compared the basal levels of expression of UBE2B in a series of colorectal cancer cell lines (Caco-2, WIDR, SW48, SW480, SW620, HCT-116). As shown in Figure 4A, we found that radioresistant cells (Caco-2 and SW480) displayed high levels of UBE2B compared to radiosensitive cells (SW48 and HCT-116). Notably, we found that ecto-expression of UBE2B in SW48 cells increased their survival after irradiation (Figure 4B). UBE2B depletion caused hypersensitivity to IR in Caco-2 cells, suggesting that UBE2B plays a vital role in modulating the genotoxicity of IR exposure (Figure 4C).

High expression of UBE2B is associated with several clinicopathologic parameters in rectal cancer following neoadjuvant CCRT. Given the ability of UBE2B to modulate the cellular response to IR, we examined the clinical relevance of UBE2B in 172 patients with rectal cancer administered neoadjuvant CCRT. The immunohistochemistry results for UBE2B in normal and tumor cells are illustrated in Figure 5A. As shown in Table I, UBE2B expression was significantly correlated with the post-treatment tumor status, post-treatment nodal status, vascular invasion, and tumor regression grade. There was no significant correlation between UBE2B expression and gender, age, pre-treatment tumor status, pre-treatment nodal status, and perineurial invasion.

Figure 1.
Figure 1.

Cells surviving from ionizing radiation express high levels of UBE2B. (A) HCT-116-R cells were those that survived exposure of HCT-116 cells to 8 Gy IR. 1×103 cells of the parental HCT-116 and HCT-116-R cells were seeded into 6 cm dishes and irradiated with 4 Gy for 14 days to study the clonogenic activity. Relative survival was defined as the number of colonies after IR divided by the number of colonies without IR. Data were statistically analyzed using paired t-test. *indicates p<0.05. (B) The levels of UBE2A, UBE2B, RNF2, RNF20, USP16, and USP22 in parental HCT-116 and HCT-116-R cells were determined by RT-qPCR analysis. Data were statistically analyzed using paired t-test. *p<0.05. (C) The levels of UBE2A and UBE2BB in parental HCT-116 and HCT-116-R cells were analyzed by immunoblots.

Figure 2.
Figure 2.

Inhibition of UBE2B elevates radiosensitivity of colon cancer cells. (A) HCT-116-R cells were transfected with sh-luciferase or sh-UBE2B plasmids for 48 h. The levels of UBE2BB in HCT-116-R cells transfected with sh-luciferase or sh-UBE2B were analyzed by immunoblots (upper right panel). Cells were treated with 2 Gy irradiation for another 14 days to study the clonogenic activity (left panel). Data were statistically analyzed using paired t-test. *indicates p<0.05 (lower right panel). (B) Parental HCT-116 and HCT-116-R cells were pre-treated for 24 h with vesicle, 1 μM, or 10 μM of the selective UBE2B inhibitor TZ9. Cells were irradiated with 2 Gy for another 14 days to study the clonogenic activity (p-values, one-way ANOVA, gene expression data were statistically analyzed using paired t-test). *indicates p<0.05, and n.s. indicates no statistically significant (lower panel). Relative survival was defined as the number of colonies after IR divided by the number of colonies without IR.

Figure 3.
Figure 3.

UBE2B is involved in regulating DNA damage response. (A) HCT-116-R cells were pre-treated with 10 μM TZ9 for 24 h. Analysis of γH2AX phosphorylation and DAPI was performed by immunofluorescence at the indicated time points after exposure to IR (2 Gy). (B) HCT-116-R cells were pre-treated with 10 μM TZ9 for 24 h. Then, cells were exposed to IR (2 Gy) for another 2 h. Foci formation of 53BP1 and Rad51 and DAPI were analyzed by immunofluorescence at the indicated time points after exposure to IR (2 Gy).

Prognostic impact of UBE2B expression for rectal cancer patients treated with neoadjuvant CCRT. The association between UBE2B expression and the prognosis of patients with rectal cancer who were administered neoadjuvant CCRT was examined by Kaplan–Meier analysis. According to univariate analysis in Table II, clinico-pathological parameters including the post-treatment tumor status, vascular invasion, tumor regression grade and UBE2B expression were predictive of DSS. The pre-treatment nodal status, post-treatment tumor status, vascular invasion, tumor regression grade, and UBE2B expression were correlated with local recurrence-free survival (LRFS). Meanwhile, post-treatment tumor status, tumor regression grade, and UBE2B were significantly associated with metastasis-free survival (MeFS). It is worth noting that high expression of UBE2B was associated with all three endpoints of our study (Figure 5B). In addition, high expression of UBE2B remained significant for DSS (p=0.03), LRFS (p=0.001) and MeFS (p=0.008) in the multivariate analysis in Table III.

Figure 4.
Figure 4.

UBE2B levels in CRC cell lines. (A) The expression levels of UBE2B in a series of colorectal cancer cells (Caco-2, SW480, and SW620, WIDR, SW48, and HCT-116) were analyzed by immunoblotting. Tubulin was used as an internal loading control. (B) SW48 cells were transfected with UBE2B expressing plasmid for 48 h. The protein levels of UBE2B were examined by immunoblot analysis (upper right panel). Parental SW48 and UBE2B over-expressing SW48 cells were treated with 4 Gy irradiation for another 14 days to study the clonogenic activity (left panel). Data were statistically analyzed using paired t-test. *indicates p<0.05 (lower right panel). (C) Caco-2 cells were transfected with sh-Luci and sh-UBE2B plasmids for 48 h. The protein levels of UBE2B were examined by immunoblot analysis (upper right panel). Cells were treated with irradiation for another 14 days to study the clonogenic activity (left panel). Data were statistically analyzed using paired t-test. *indicates p<0.05 (lower right panel). Relative survival was defined as the number of colonies after IR divided by the number of colonies without IR.

Figure 5.
Figure 5.

Kaplan–Meier survival curves plotted to predict survival. (A) The non-neoplastic mucosa reveals no expression of UBE2B as compared with rectal cancers with low expression and high expression of UBE2B in patients with no treatment. (B) Using the log-rank test, high expression of UBE2B predicts inferior disease specific survival (p=0.0032), as well as local recurrence free survival (p=0.0011). It also significantly predicts metastasis-free survival (p=0.0008).

Discussion

UBE2B is a ubiquitin-conjugating enzyme of 17-kDa molecular weight. The protein is highly conserved in all eukaryotes. The protein was originally identified as a DNA repair protein. Previous studies have demonstrated that both UBE2B and UBE2A regulate DNA damage tolerance and DNA repair pathways by forming a ubiquitination complex with the E3 ubiquitin-protein ligase RAD18 (11, 22). UBE2A and UBE2B have similar ubiquitin conjugating activities and share 95% sequence identity with each other in humans (23). However, in contrast to UBE2A UBE2B has been demonstrated to have a relationship with histone modification and carcinogenesis. UBE2B-mediated histone modification is crucial for DNA repair and damage tolerance (24). Furthermore, UBE2B regulates gene transcription via histone 2B ubiquitination-mediated chromatin modifications and leads to changes in DNA damage tolerance (12, 13, 25). Besides its role as a DDR protein, UBE2B has been reported to play a role in the malignant phenotype of cancers. Gajan et al. has identified UBE2B splice variants that represent truncated UBE2B or modified functional versions of the parent UBE2B to be selectively increased in melanoma cell lines and patient-derived melanoma brain metastases (26). The over-expression of UBE2B has also been observed in breast cancer and ovarian cancer and is associated with tumorigenesis and platinum resistance (25, 27, 28). In breast cancer, UBE2B stabilizes β-catenin by adding a K63-linked polyubiquitin chain to Lys394 of β-catenin (29, 30). However, the detailed mechanism of carcinogenesis and the chemoradiotherapy response controlled by UBE2B remains largely unknown.

View this table:
Table I.

The correlations between UBE2B expression and clinicopathological factors in 172 rectal cancer patients receiving neoadjuvant CCRT.

UBE2B has been reported to mainly play a role in controlling the error-prone and the error-free DNA damage repair pathway by regulating the ubiquitination of the PCNA protein (31). UBE2B regulates the ubiquitination of the PCNA protein by co-operating with the E3 ligase RAD18, which recruits UBE2B to chromatin to regulate the mono-ubiquitination of PCNA at Lys164 (11, 32). The mono-ubiquitinated PCNA is crucial for error-prone DNA damage repair. Furthermore, UBE2B and the heterodimeric ubiquitin-conjugating enzyme, formed by UBC13 and MMS2, are recruited to chromatin through the interaction with the RING-finger-containing RAD18-RAD5 complex. This large complex is required for error-free DNA damage repair (11, 22). UBE2B initiates different DNA damage repair pathways to repair damaged DNA in both error-prone and error-free manners. However, it is noteworthy that our data indicated that UBE2B expression was significantly correlated with tumor regression grade (Table I). UBE2B deficiency elevated radiosensitivity (Figure 2). These results indicated that other DDRs are involved in the UBE2B-mediated regulation of DNA damage repair in CRC cells. It has recently been shown that UBE2A/2B work together with RNF168 in recruiting DNA damage repair proteins, such as BRCA1 and 53BP1, to the damaged site after ionizing radiation (IR) of U2OS cells (21). To address the role of UBE2B-mediated DNA repair in CRC cells, we quantified the formation of γ-H2AX, 53BP1, and Rad51 foci after IR exposure. As shown in Figure 3, we found that loss of UBE2B triggered the endogenous DNA damage and elongation of DNA repair ability. These results suggested that UBE2B is required for genomic stability and the IR-mediated DNA repair pathway.

A few clinical studies have evaluated microsatellite instability (MSI) status of cancers as a marker of radiation response (33-35). MSI has been shown to predict radiation outcome in early-stage endometrial cancer (35), but its relationship with radiation response in rectal cancer has not been demonstrated (33, 34). This discrepancy might be explained by fewer MSI-related rectal cancers. MSI constitutes about 2-9.3% of rectal cancer (36, 37), while MSI is present in 20%-30% of endometrial cancer (38). Accumulating evidence suggests that DNA mismatch repair (MMR) proteins may directly and indirectly influence DDR after radiation. MSI tumors have increased mutation rates of not only the DSB recognition proteins ATM and MRE11 (38, 39), but also of DNA PKcs, which is necessary for non-homologous end joining repair of DSBs (40). The radiation sensitivity of MSI tumors may also result from a loss of MMR proteins, which play a crucial direct role in the pathways affecting cell cycle arrest, subsequent DSB repair and apoptosis after IR (41-45). As shown in Figure 4A, we examined the UBE2B levels in microsatellite stable (Caco2, SW480, and SW620) and microsatellite unstable (WIDR, SW48, and HCT-116) cell lines by immunoblotting. These results suggested that a positive correlation between UBE2B and MSI might provide another potential mechanism for maintaining genome stability. However, the hypothesis still needs to be further clarified.

Clinical data related to the role of UBE2B in patients administered neoadjuvant CCRT are limited. This is the first study to use immunohistochemistry and surgical samples from patients administered neoadjuvant CCRT and subjected to radical surgery to investigate the CCRT response and prognostic significance of UBE2B in human CRC. We demonstrated that the expression of UBE2B in CRC tissues after IR was closely correlated with several clinicopathologic parameters, including vascular invasion, post-CCRT status of size, spread of the tumor, and tumor regression grade (Table I). In addition, high UBE2B expression was significantly associated with all three endpoints of our study. We highlight that high UBE2B expression was significantly associated with MeFS even in the multivariate analysis. Consistent with the in vivo data, our results indicated that UBE2B plays a role in modulating the cell response to IR exposure. Knockdown of UBE2B significantly enhanced the genotoxicity effect of IR in radioresistant cells (HCT-116-R and Caco-2 cells). In contrast, UBE2B over-expression elevated the sensitivity of SW48 cells to IR exposure (Figure 2). Because the treatment response to IR stems from the DNA damage directly caused by IR and indirectly from the formation of free radicals (46), high expression of UBE2B, which regulates DNA damage tolerance and initiates the DNA repair pathway, may result in worse outcomes after radiotherapy, including reduced tumor regression and poor survival. The development of radiation resistance is highly unpredictable, and our clinical and in vitro results suggest that the expression levels of UBE2B are highly correlated with radioresistance and lower survival. However, our in vitro results cannot explain how UBE2B expression influences MeFS. Published evidence reveals that while cancer cells with high UBE2B expression comprise cells with epithelial–mesenchymal transition (EMT) phenotype, cancer cells with low UBE2B expression lack this phenotype (30). The initiation of metastasis requires EMT (47, 48). In conclusion, we hypothesize that UBE2B increases metastasis by upregulating the EMT phenotype. As a result, patients with low UBE2B expression levels have better MeFS than patients with high UBE2B expression levels.

View this table:
Table II.

Univariate log-rank analysis for UBE2B expression.

View this table:
Table III.

Multivariate analysis.

In recent decades, numerous studies have evaluated the use of neoadjuvant therapy for locally advanced rectal cancer. Adding the radiosensitizer oxaliplatin to current fluoropyrimidine-based CRT failed to increase the pCR rate or downstage, but dramatically increased adverse effects (49, 50). Preclinical and clinical data indicate that the VEGF-specific antibody bevacizumab has anti-vascular effects in rectal cancer (51). However, attempts to administer bevacizumab concomitantly with fluoropyrimidine-based CRT have only shown mild to no benefits in terms of pCR, with a slight increase in peri-operative complications (52, 53). Preclinical evidence suggests that the EGFR inhibitor cetuximab is a potent radiosensitizer. However, pCR was not improved by the addition of cetuximab (54, 55). In contrast to the disappointing results of combining radiation with platinum-based antineoplastic drugs, VEGF-specific antibody, and EGFR inhibitor, our findings indicate that adding the UBE2B inhibitor enhanced the radiation response and reversed the acquired radioresistance in rectal cancer cells. Recent studies have reported that high levels of UBE2B increased stemness-related gene expression and led to the acquisition of stem cell phenotype, contributing to the recurrence and metastasis of ovarian cancer (56). Inhibition of UBE2B induced G2-M arrest and apoptosis in breast cancer. Moreover, the depletion of UBE2B has been shown to sensitize nasopharyngeal carcinoma cells to 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU) by regulating ubiquitination of O6-methylguanine-DNA methyl-transferase (57). Treatment with a UBE2B inhibitor has been shown to sensitize CRC cells to platinum drug-based treatment (58). Thus, UBE2B may regulate the sensitivity of cancer cells to various chemotherapeutic drugs through DNA damage tolerance and repair efficiency. Herein, we provide more evidence showing that UBE2B might be a potential target for developing agents to improve the efficacy of CCRT for rectal cancer.

Based on our results, we conclude that UBE2B is an appropriate biomarker to predict the outcome of CCRT and guide the development of agents to improve the efficacy of CCRT for rectal cancer. Future studies need to identify the E3 ligase downstream of UBE2B and the mechanistic association with MSI, as well as evaluate the efficacy of UBE2B inhibitors in vivo. Our findings may further the clinical use of CCRT for rectal cancer treatment.

Acknowledgements

The Authors acknowledge the support from the following grants: (1) KMUH106-6M12 and KMUH107-7M12 from the Kaohsiung Medical University Hospital; (2) MOHW107-TDU-B-212-112-015 from the Ministry of Health and Welfare, Taiwan; (3) KMU-DK108011 from KMU-KMUH Co-Project of Key Research; (4) 105-2314-B-037-038-MY3 and 106-2314-B-037-049-MY3 from the Ministry of Health and Welfare, Taiwan; (5) KMU-DK109003 and 108CM-KMU-06 from Kaohsiung Medical University; (6) KMU-TC108A04 from Kaohsiung Medical University Research Center Grant.

Footnotes

  • Authors' Contributions

    WLH, CWL and MRP designed and conducted experiments, acquired and analyzed the data, wrote the article. CLC, CCY collected patient tissues. TJC and CFL conducted experiments analyzed the data of immunohistochemistry. MRP reviewed the manuscript and provided administrative support.

  • Conflicts of Interest

    The Authors declare no conflicts of interest regarding this study.

  • Received September 11, 2020.
  • Revision received September 22, 2020.
  • Accepted September 24, 2020.

References

  1. ↵
    1. Arnold M,
    2. Sierra MS,
    3. Laversanne M,
    4. Soerjomataram I,
    5. Jemal A,
    6. Bray F
    : Global patterns and trends in colorectal cancer incidence and mortality. Gut 66(4): 683-691, 2017. PMID: 26818619. DOI: 10.1136/gutjnl-2015-310912
    OpenUrlAbstract/FREE Full Text
  2. ↵
    1. Bray F,
    2. Ferlay J,
    3. Soerjomataram I,
    4. Siegel RL,
    5. Torre LA,
    6. Jemal A
    : Global cancer statistics 2018: Globocan estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 68(6): 394-424, 2018. PMID: 30207593. DOI: 10.3322/caac.21492
    OpenUrlCrossRefPubMed
  3. ↵
    1. Health Promotion Administration, Ministry of Health and Welfare, Taiwan
    . Cancer registry annual report, 2016. Available at: https://www.hpa.gov.tw/Pages/Detail.aspx?nodeid=269&pid=10227 [Last accessed September 21, 2020]
  4. ↵
    1. Bosset JF,
    2. Collette L,
    3. Calais G,
    4. Mineur L,
    5. Maingon P,
    6. Radosevic-Jelic L,
    7. Daban A,
    8. Bardet E,
    9. Beny A,
    10. Ollier JC
    : Chemotherapy with preoperative radiotherapy in rectal cancer. N Engl J Med 355(11): 1114-1123, 2006. PMID: 16971718. DOI: 10.1056/NEJMoa060829
    OpenUrlCrossRefPubMed
  5. ↵
    1. Brierley JD,
    2. Cummings BJ,
    3. Wong CS,
    4. Keane TJ,
    5. O'Sullivan B,
    6. Catton CN,
    7. Goodman P
    : Adenocarcinoma of the rectum treated by radical external radiation therapy. Int J Radiat Oncol Biol Phys 31(2): 255-259, 1995. PMID: 7836077. DOI: 10.1016/0360-3016(94)e0102-p
    OpenUrlCrossRefPubMed
  6. ↵
    1. Guillem JG,
    2. Chessin DB,
    3. Cohen AM,
    4. Shia J,
    5. Mazumdar M,
    6. Enker W,
    7. Paty PB,
    8. Weiser MR,
    9. Klimstra D,
    10. Saltz L,
    11. Minsky BD,
    12. Wong WD
    : Long-term oncologic outcome following preoperative combined modality therapy and total mesorectal excision of locally advanced rectal cancer. Ann Surg 241(5): 829-836; discussion 836-828, 2005. PMID: 15849519. DOI: 10.1097/01.sla.0000161980.46459.96
    OpenUrlCrossRefPubMed
  7. ↵
    1. Bosset JF,
    2. Magnin V,
    3. Maingon P,
    4. Mantion G,
    5. Pelissier EP,
    6. Mercier M,
    7. Chaillard G,
    8. Horiot JC
    : Preoperative radiochemotherapy in rectal cancer: Long-term results of a phase ii trial. Int J Radiat Oncol Biol Phys 46(2): 323-327, 2000. PMID: 10661338. DOI: 10.1016/s0360-3016(99)00411-3
    OpenUrlCrossRefPubMed
    1. de la Torre A,
    2. Ramos S,
    3. Valcarcel FJ,
    4. Candal A,
    5. Regueiro CA,
    6. Romero J,
    7. Magallon R,
    8. Salinas J,
    9. de las Heras M,
    10. Veiras C,
    11. Tisaire JL,
    12. Aragon G
    : Phase ii study of radiochemotherapy with uft and low-dose oral leucovorin in patients with unresectable rectal cancer. Int J Radiat Oncol Biol Phys 45(3): 629-634, 1999. PMID: 10524415. DOI: 10.1016/s0360-3016(99)00225-4
    OpenUrlCrossRefPubMed
  9. ↵
    1. Seong J,
    2. Cho JH,
    3. Kim NK,
    4. Min JS,
    5. Suh CO
    : Preoperative chemoradiotherapy with oral doxifluridine plus low-dose oral leucovorin in unresectable primary rectal cancer. Int J Radiat Oncol Biol Phys 50(2): 435-439, 2001. PMID: 11380231. DOI: 10.1016/s0360-3016(00)01585-6
    OpenUrlCrossRefPubMed
  10. ↵
    1. Maas M,
    2. Nelemans PJ,
    3. Valentini V,
    4. Das P,
    5. Rodel C,
    6. Kuo LJ,
    7. Calvo FA,
    8. Garcia-Aguilar J,
    9. Glynne-Jones R,
    10. Haustermans K,
    11. Mohiuddin M,
    12. Pucciarelli S,
    13. Small W Jr..,
    14. Suarez J,
    15. Theodoropoulos G,
    16. Biondo S,
    17. Beets-Tan RG,
    18. Beets GL
    : Long-term outcome in patients with a pathological complete response after chemoradiation for rectal cancer: A pooled analysis of individual patient data. Lancet Oncol 11(9): 835-844, 2010. PMID: 20692872. DOI: 10.1016/S1470-2045(10)70172-8
    OpenUrlCrossRefPubMed
  11. ↵
    1. Hoege C,
    2. Pfander B,
    3. Moldovan GL,
    4. Pyrowolakis G,
    5. Jentsch S
    : Rad6-dependent DNA repair is linked to modification of pcna by ubiquitin and sumo. Nature 419(6903): 135-141, 2002. PMID: 12226657. DOI: 10.1038/nature00991
    OpenUrlCrossRefPubMed
  12. ↵
    1. Robzyk K,
    2. Recht J,
    3. Osley MA
    : Rad6-dependent ubiquitination of histone h2b in yeast. Science 287(5452): 501-504, 2000. PMID: 10642555. DOI: 10.1126/science.287.5452.501
    OpenUrlAbstract/FREE Full Text
  13. ↵
    1. Kao CF,
    2. Hillyer C,
    3. Tsukuda T,
    4. Henry K,
    5. Berger S,
    6. Osley MA
    : Rad6 plays a role in transcriptional activation through ubiquitylation of histone H2B. Genes Dev 18(2): 184-195, 2004. PMID: 14752010. DOI: 10.1101/gad.1149604
    OpenUrlAbstract/FREE Full Text
  14. ↵
    1. Zhang Z,
    2. Yang H,
    3. Wang H
    : The histone H2A deubiquitinase USP16 interacts with HERC2 and fine-tunes cellular response to DNA damage. J Biol Chem 289(47): 32883-32894, 2014. PMID: 25305019. DOI: 10.1074/jbc.M114.599605
    OpenUrlAbstract/FREE Full Text
  15. ↵
    1. Liu J,
    2. Kruswick A,
    3. Dang H,
    4. Tran AD,
    5. Kwon SM,
    6. Wang XW,
    7. Oberdoerffer P
    : Ubiquitin-specific protease 21 stabilizes brca2 to control DNA repair and tumor growth. Nat Commun 8(1): 137, 2017. PMID: 28743957. DOI: 10.1038/s41467-017-00206-2
    OpenUrlCrossRef
  16. ↵
    1. Ramachandran S,
    2. Haddad D,
    3. Li C,
    4. Le MX,
    5. Ling AK,
    6. So CC,
    7. Nepal RM,
    8. Gommerman JL,
    9. Yu K,
    10. Ketela T,
    11. Moffat J,
    12. Martin A
    : The saga deubiquitination module promotes DNA repair and class switch recombination through atm and dnapk-mediated gammah2ax formation. Cell Rep 15(7): 1554-1565, 2016. PMID: 27160905. DOI: 10.1016/j.celrep.2016.04.041
    OpenUrlCrossRefPubMed
  17. ↵
    1. Yin HL,
    2. Wu CC,
    3. Lin CH,
    4. Chai CY,
    5. Hou MF,
    6. Chang SJ,
    7. Tsai HP,
    8. Hung WC,
    9. Pan MR,
    10. Luo CW
    : Beta1 integrin as a prognostic and predictive marker in triple-negative breast cancer. Int J Mol Sci 17(9), 2016. PMID: 27589736. DOI: 10.3390/ijms17091432
  18. ↵
    1. Lin CY,
    2. Tian YF,
    3. Wu LC,
    4. Chen LT,
    5. Lin LC,
    6. Hsing CH,
    7. Lee SW,
    8. Sheu MJ,
    9. Lee HH,
    10. Wang YH,
    11. Shiue YL,
    12. Wu WR,
    13. Huang HY,
    14. Hsu HP,
    15. Li CF,
    16. Chen SH
    : Rsf-1 expression in rectal cancer: With special emphasis on the independent prognostic value after neoadjuvant chemoradiation. J Clin Pathol 65(8): 687-692, 2012. PMID: 22569540. DOI: 10.1136/jclinpath-2012-200786
    OpenUrlAbstract/FREE Full Text
  19. ↵
    1. Dworak O,
    2. Keilholz L,
    3. Hoffmann A
    : Pathological features of rectal cancer after preoperative radiochemotherapy. Int J Colorectal Dis 12(1): 19-23, 1997. PMID: 9112145. DOI: 10.1007/s003840050072
    OpenUrlCrossRefPubMed
  20. ↵
    1. Ramzan Z,
    2. Nassri AB,
    3. Huerta S
    : Genotypic characteristics of resistant tumors to pre-operative ionizing radiation in rectal cancer. World J Gastrointest Oncol 6(7): 194-210, 2014. PMID: 25024812. DOI: 10.4251/wjgo.v6.i7.194
    OpenUrl
  21. ↵
    1. Liu C,
    2. Wang D,
    3. Wu J,
    4. Keller J,
    5. Ma T,
    6. Yu X
    : Rnf168 forms a functional complex with rad6 during the DNA damage response. J Cell Sci 126(Pt 9): 2042-2051, 2013. PMID: 23525009. DOI: 10.1242/jcs.122945
    OpenUrlAbstract/FREE Full Text
  22. ↵
    1. Bailly V,
    2. Lamb J,
    3. Sung P,
    4. Prakash S,
    5. Prakash L
    : Specific complex formation between yeast rad6 and rad18 proteins: A potential mechanism for targeting rad6 ubiquitin-conjugating activity to DNA damage sites. Genes Dev 8(7): 811-820, 1994. PMID: 7926769. DOI: 10.1101/gad.8.7.811
    OpenUrlAbstract/FREE Full Text
  23. ↵
    1. Koken MH,
    2. Reynolds P,
    3. Jaspers-Dekker I,
    4. Prakash L,
    5. Prakash S,
    6. Bootsma D,
    7. Hoeijmakers JH
    : Structural and functional conservation of two human homologs of the yeast DNA repair gene rad6. Proc Natl Acad Sci U S A 88(20): 8865-8869, 1991. PMID: 1717990. DOI: 10.1073/pnas.88.20.8865
    OpenUrlAbstract/FREE Full Text
  24. ↵
    1. Hung SH,
    2. Wong RP,
    3. Ulrich HD,
    4. Kao CF
    : Monoubiquitylation of histone h2b contributes to the bypass of DNA damage during and after DNA replication. Proc Natl Acad Sci USA 114(11): E2205-e2214, 2017. PMID: 28246327. DOI: 10.1073/pnas.1612633114
    OpenUrlAbstract/FREE Full Text
  25. ↵
    1. Lyakhovich A,
    2. Shekhar MP
    : Rad6b overexpression confers chemoresistance: Rad6 expression during cell cycle and its redistribution to chromatin during DNA damage-induced response. Oncogene 23(17): 3097-3106, 2004. PMID: 14981545. DOI: 10.1038/sj.onc.1207449
    OpenUrlCrossRefPubMed
  26. ↵
    1. Gajan A,
    2. Martin CE,
    3. Kim S,
    4. Joshi M,
    5. Michelhaugh SK,
    6. Joshi M,
    7. Michelhaugh SK,
    8. Sloma I,
    9. Mittal S,
    10. Firestine S,
    11. Shekhar MPV
    : Alternative splicing of rad6b and not rad6a is selectively increased in melanoma: Identification and functional characterization. Cells 8(11):1375, 2019. PMID: 31683936. DOI: 10.3390/cells8111375
    OpenUrl
  27. ↵
    1. Shekhar MP,
    2. Lyakhovich A,
    3. Visscher DW,
    4. Heng H,
    5. Kondrat N
    : Rad6 overexpression induces multinucleation, centrosome amplification, abnormal mitosis, aneuploidy, and transformation. Cancer Res 62(7): 2115-2124, 2002. PMID: 11929833.
    OpenUrlAbstract/FREE Full Text
  28. ↵
    1. Lyakhovich A,
    2. Shekhar MP
    : Supramolecular complex formation between rad6 and proteins of the p53 pathway during DNA damage-induced response. Mol Cell Biol 23(7): 2463-2475, 2003. PMID: 12640129. DOI: 10.1128/mcb.23.7.2463-2475.2003
    OpenUrlAbstract/FREE Full Text
  29. ↵
    1. Gerard B,
    2. Sanders MA,
    3. Visscher DW,
    4. Tait L,
    5. Shekhar MP
    : Lysine 394 is a novel rad6b-induced ubiquitination site on beta-catenin. Biochim Biophys Acta 1823(10): 1686-1696, 2012. PMID: 22705350. DOI: 10.1016/j.bbamcr.2012.05.032
    OpenUrlPubMed
  30. ↵
    1. Shekhar MP,
    2. Gerard B,
    3. Pauley RJ,
    4. Williams BO,
    5. Tait L
    : Rad6b is a positive regulator of beta-catenin stabilization. Cancer Res 68(6): 1741-1750, 2008. PMID: 18339854. DOI: 10.1158/0008-5472.CAN-07-2111
    OpenUrlAbstract/FREE Full Text
  31. ↵
    1. Pfander B,
    2. Moldovan GL,
    3. Sacher M,
    4. Hoege C,
    5. Jentsch S
    : Sumo-modified pcna recruits srs2 to prevent recombination during s phase. Nature 436(7049): 428-433, 2005. PMID: 15931174. DOI: 10.1038/nature03665
    OpenUrlCrossRefPubMed
  32. ↵
    1. Ulrich HD,
    2. Jentsch S
    : Two ring finger proteins mediate cooperation between ubiquitin-conjugating enzymes in DNA repair. Embo J 19(13): 3388-3397, 2000. PMID: 10880451. DOI: 10.1093/emboj/19.13.3388
    OpenUrlAbstract/FREE Full Text
  33. ↵
    1. Kuremsky JG,
    2. Tepper JE,
    3. McLeod HL
    : Biomarkers for response to neoadjuvant chemoradiation for rectal cancer. Int J Radiat Oncol Biol Phys 74(3): 673-688, 2009. PMID: 19480968. DOI: 10.1016/j.ijrobp.2009.03.003
    OpenUrlCrossRefPubMed
  34. ↵
    1. Smith FM,
    2. Reynolds JV,
    3. Miller N,
    4. Stephens RB,
    5. Kennedy MJ
    : Pathological and molecular predictors of the response of rectal cancer to neoadjuvant radiochemotherapy. Eur J Surg Oncol 32(1): 55-64, 2006. PMID: 16324817. DOI: 10.1016/j.ejso.2005.09.010
    OpenUrlCrossRefPubMed
  35. ↵
    1. Bilbao C,
    2. Lara PC,
    3. Ramirez R,
    4. Henriquez-Hernandez LA,
    5. Rodriguez G,
    6. Falcon O,
    7. Leon L,
    8. Perucho M,
    9. Diaz-Chico BN,
    10. Diaz-Chico JC
    : Microsatellite instability predicts clinical outcome in radiation-treated endometrioid endometrial cancer. Int J Radiat Oncol Biol Phys 76(1): 9-13, 2010. PMID: 20005452. DOI: 10.1016/j.ijrobp.2009.09.035
    OpenUrlCrossRefPubMed
  36. ↵
    1. Oh CR,
    2. Kim JE,
    3. Kang J,
    4. Kim SY,
    5. Kim KP,
    6. Hong YS,
    7. Lim SB,
    8. Yu CS,
    9. Kim JC,
    10. Kim J,
    11. Jang SJ,
    12. Kim TW
    : Prognostic value of the microsatellite instability status in patients with stage ii/iii rectal cancer following upfront surgery. Clin Colorectal Cancer 17(4): e679-e685, 2018. PMID: 30077598. DOI: 10.1016/j.clcc.2018.07.003
    OpenUrl
  37. ↵
    1. Shin J-S,
    2. Tut TG,
    3. Yang T,
    4. Lee CS
    : Radiotherapy response in microsatellite instability related rectal cancer. Korean J Pathol 47(1): 1-8, 2013. PMID: 23482947. DOI: 10.4132/KoreanJPathol.2013.47.1.1
    OpenUrlCrossRefPubMed
  38. ↵
    1. Ham MF,
    2. Takakuwa T,
    3. Luo WJ,
    4. Liu A,
    5. Horii A,
    6. Aozasa K
    : Impairment of double-strand breaks repair and aberrant splicing of atm and mre11 in leukemia-lymphoma cell lines with microsatellite instability. Cancer Sci 97(3): 226-234, 2006. PMID: 16542220. DOI: 10.1111/j.1349-7006.2006.00165.x
    OpenUrlCrossRefPubMed
  39. ↵
    1. Giannini G,
    2. Rinaldi C,
    3. Ristori E,
    4. Ambrosini MI,
    5. Cerignoli F,
    6. Viel A,
    7. Bidoli E,
    8. Berni S,
    9. D'Amati G,
    10. Scambia G,
    11. Frati L,
    12. Screpanti I,
    13. Gulino A
    : Mutations of an intronic repeat induce impaired mre11 expression in primary human cancer with microsatellite instability. Oncogene 23(15): 2640-2647, 2004. PMID: 15048091. DOI: 10.1038/sj.onc.1207409
    OpenUrlCrossRefPubMed
  40. ↵
    1. Miquel C,
    2. Jacob S,
    3. Grandjouan S,
    4. Aime A,
    5. Viguier J,
    6. Sabourin JC,
    7. Sarasin A,
    8. Duval A,
    9. Praz F
    : Frequent alteration of DNA damage signalling and repair pathways in human colorectal cancers with microsatellite instability. Oncogene 26(40): 5919-5926, 2007. PMID: 17384679. DOI: 10.1038/sj.onc.1210419
    OpenUrlCrossRefPubMed
  41. ↵
    1. Zhang Y,
    2. Rohde LH,
    3. Emami K,
    4. Hammond D,
    5. Casey R,
    6. Mehta SK,
    7. Jeevarajan AS,
    8. Pierson DL,
    9. Wu H
    : Suppressed expression of non-dsb repair genes inhibits gamma-radiation-induced cytogenetic repair and cell cycle arrest. DNA Repair (Amst) 7(11): 1835-1845, 2008. PMID: 18703169. DOI: 10.1016/j.dnarep.2008.07.009
    OpenUrlCrossRefPubMed
    1. Zhang Y,
    2. Rohde LH,
    3. Wu H
    : Involvement of nucleotide excision and mismatch repair mechanisms in double strand break repair. Curr Genomics 10(4): 250-258, 2009. PMID: 19949546. DOI: 10.2174/138920209788488544
    OpenUrlCrossRefPubMed
    1. Chen J,
    2. Sadowski I
    : Identification of the mismatch repair genes pms2 and mlh1 as p53 target genes by using serial analysis of binding elements. Proc Natl Acad Sci USA 102(13): 4813-4818, 2005. PMID: 15781865. DOI: 10.1073/pnas.0407069102
    OpenUrlAbstract/FREE Full Text
    1. Franchitto A,
    2. Pichierri P,
    3. Piergentili R,
    4. Crescenzi M,
    5. Bignami M,
    6. Palitti F
    : The mammalian mismatch repair protein msh2 is required for correct mre11 and rad51 relocalization and for efficient cell cycle arrest induced by ionizing radiation in g2 phase. Oncogene 22(14): 2110-2120, 2003. PMID: 12687013. DOI: 10.1038/sj.onc.1206254
    OpenUrlCrossRefPubMed
  45. ↵
    1. Habraken Y,
    2. Jolois O,
    3. Piette J
    : Differential involvement of the hmre11/hrad50/nbs1 complex, brca1 and mlh1 in nf-kappab activation by camptothecin and x-ray. Oncogene 22(38): 6090-6099, 2003. PMID: 12955088. DOI: 10.1038/sj.onc.1206893
    OpenUrlCrossRefPubMed
  46. ↵
    1. Mettler FA
    : Medical effects and risks of exposure to ionising radiation. J Radiol Prot 32(1): N9-n13, 2012. PMID: 22395124. DOI: 10.1088/0952-4746/32/1/N9
    OpenUrlCrossRefPubMed
  47. ↵
    1. Hanahan D,
    2. Weinberg RA
    : The hallmarks of cancer. Cell 100(1): 57-70, 2000. PMID: 10647931. DOI: 10.1016/s0092-8674(00)81683-9
    OpenUrlCrossRefPubMed
  48. ↵
    1. Hanahan D,
    2. Weinberg RA
    : Hallmarks of cancer: The next generation. Cell 144(5): 646-674, 2011. PMID: 21376230. DOI: 10.1016/j.cell.2011.02.013
    OpenUrlCrossRefPubMed
  49. ↵
    1. Roh M,
    2. Yothers G,
    3. O'Connell M,
    4. Beart R,
    5. Pitot H,
    6. Shields A,
    7. Parda D,
    8. Sharif S,
    9. Allegra C,
    10. Petrelli N
    : The impact of capecitabine and oxaliplatin in the preoperative multimodality treatment in patients with carcinoma of the rectum: Nsabp r-04. J Clin Oncol 29(15_suppl): 3503-3503, 2011. PMID: 28020345. DOI: 10.1200/jco.2011.29.15_suppl.3503
    OpenUrlAbstract/FREE Full Text
  50. ↵
    1. Gerard JP,
    2. Azria D,
    3. Gourgou-Bourgade S,
    4. Martel-Laffay I,
    5. Hennequin C,
    6. Etienne PL,
    7. Vendrely V,
    8. Francois E,
    9. de La Roche G,
    10. Bouche O,
    11. Mirabel X,
    12. Denis B,
    13. Mineur L,
    14. Berdah JF,
    15. Mahe MA,
    16. Becouarn Y,
    17. Dupuis O,
    18. Lledo G,
    19. Montoto-Grillot C,
    20. Conroy T
    : Comparison of two neoadjuvant chemoradiotherapy regimens for locally advanced rectal cancer: Results of the phase III trial accord 12/0405-prodige 2. J Clin Oncol 28(10): 1638-1644, 2010. PMID: 20194850. DOI: 10.1200/jco.2009.25.8376
    OpenUrlAbstract/FREE Full Text
  51. ↵
    1. Willett CG,
    2. Boucher Y,
    3. di Tomaso E,
    4. Duda DG,
    5. Munn LL,
    6. Tong RT,
    7. Chung DC,
    8. Sahani DV,
    9. Kalva SP,
    10. Kozin SV,
    11. Mino M,
    12. Cohen KS,
    13. Scadden DT,
    14. Hartford AC,
    15. Fischman AJ,
    16. Clark JW,
    17. Ryan DP,
    18. Zhu AX,
    19. Blaszkowsky LS,
    20. Chen HX,
    21. Shellito PC,
    22. Lauwers GY,
    23. Jain RK
    : Direct evidence that the vegf-specific antibody bevacizumab has antivascular effects in human rectal cancer. Nat Med 10(2): 145-147, 2004. PMID: 14745444. DOI: 10.1038/nm988
    OpenUrlCrossRefPubMed
  52. ↵
    1. Willett CG,
    2. Duda DG,
    3. di Tomaso E,
    4. Boucher Y,
    5. Ancukiewicz M,
    6. Sahani DV,
    7. Lahdenranta J,
    8. Chung DC,
    9. Fischman AJ,
    10. Lauwers GY,
    11. Shellito P,
    12. Czito BG,
    13. Wong TZ,
    14. Paulson E,
    15. Poleski M,
    16. Vujaskovic Z,
    17. Bentley R,
    18. Chen HX,
    19. Clark JW,
    20. Jain RK
    : Efficacy, safety, and biomarkers of neoadjuvant bevacizumab, radiation therapy, and fluorouracil in rectal cancer: A multidisciplinary phase II study. J Clin Oncol 27(18): 3020-3026, 2009. PMID: 19470921. DOI: 10.1200/jco.2008.21.1771
    OpenUrlAbstract/FREE Full Text
  53. ↵
    1. Velenik V,
    2. Ocvirk J,
    3. Music M,
    4. Bracko M,
    5. Anderluh F,
    6. Oblak I,
    7. Edhemovic I,
    8. Brecelj E,
    9. Kropivnik M,
    10. Omejc M
    : Neoadjuvant capecitabine, radiotherapy, and bevacizumab (crab) in locally advanced rectal cancer: Results of an open-label phase II study. Radiat Oncol 6: 105, 2011. PMID: 21880132. DOI: 10.1186/1748-717x-6-105
    OpenUrlCrossRefPubMed
  54. ↵
    1. Chung KY,
    2. Minsky B,
    3. Schrag D,
    4. O'Reilly E,
    5. D'Adamo D,
    6. Hollywood E,
    7. Quinones M,
    8. Saltz L
    : Phase i trial of preoperative cetuximab with concurrent continuous infusion 5-fluorouracil and pelvic radiation in patients with local-regionally advanced rectal cancer. J Clin Oncol 24(18_suppl): 3560-3560, 2006. PMID: 27953271. DOI: 10.1200/jco.2006.24.18_suppl.3560
    OpenUrl
  55. ↵
    1. Bertolini F,
    2. Chiara S,
    3. Bengala C,
    4. Antognoni P,
    5. Dealis C,
    6. Zironi S,
    7. Malavasi N,
    8. Scolaro T,
    9. Depenni R,
    10. Jovic G,
    11. Sonaglio C,
    12. Rossi A,
    13. Luppi G,
    14. Conte PF
    : Neoadjuvant treatment with single-agent cetuximab followed by 5-fu, cetuximab, and pelvic radiotherapy: A phase ii study in locally advanced rectal cancer. Int J Radiat Oncol Biol Phys 73(2): 466-472, 2009. PMID: 19004567. DOI: 10.1016/j.ijrobp.2008.04.065
    OpenUrlCrossRefPubMed
  56. ↵
    1. Somasagara RR,
    2. Spencer SM,
    3. Tripathi K,
    4. Clark DW,
    5. Mani C,
    6. Madeira da Silva L,
    7. Scalici J,
    8. Kothayer H,
    9. Westwell AD,
    10. Rocconi RP,
    11. Palle K
    : Rad6 promotes DNA repair and stem cell signaling in ovarian cancer and is a promising therapeutic target to prevent and treat acquired chemoresistance. Oncogene 36(48): 6680-6690, 2017. PMID: 28806395. DOI: 10.1038/onc.2017.279
    OpenUrl
  57. ↵
    1. Hsu SH,
    2. Chen SH,
    3. Kuo CC,
    4. Chang JY
    : Ubiquitin-conjugating enzyme e2 b regulates the ubiquitination of o(6)-methylguanine-DNA methyltransferase and bcnu sensitivity in human nasopharyngeal carcinoma cells. Biochem Pharmacol 158: 327-338, 2018. PMID: 30449727. DOI: 10.1016/j.bcp.2018.10.029
    OpenUrl
  58. ↵
    1. Sanders MA,
    2. Haynes B,
    3. Nangia-Makker P,
    4. Polin LA,
    5. Shekhar MP
    : Pharmacological targeting of rad6 enzyme-mediated translesion synthesis overcomes resistance to platinum-based drugs. J Biol Chem 292(25): 10347-10363, 2017. PMID: 28490629. DOI: 10.1074/jbc.M117.792192
    OpenUrlAbstract/FREE Full Text
Back to top

In this issue

Print
Download PDF
Article Alerts
Email Article
Citation Tools
Reprints and Permissions
High Expression of UBE2B as a Poor Prognosis Factor in Patients With Rectal Cancer Following Chemoradiotherapy
WEI-LUN HUANG, CHI-WEN LUO, CHIA-LIN CHOU, CHING-CHIEH YANG, TZU-JU CHEN, CHIEN-FENG LI, MEI-REN PAN
Anticancer Research Nov 2020, 40 (11) 6305-6317; DOI: 10.21873/anticanres.14651
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo

Jump to section

Keywords