Moesin Up-regulation Is Associated with Enhanced Tumor Progression Imaged Non-invasively in an Orthotopic Mouse Model of Human Glioblastoma

Materials and Methods

Cell culture and transfection. The glioblastoma cell line U87 was purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences. U87-GFP cells were obtained from AntiCancer Inc. (San Diego, CA, USA). All cells were cultured in RPMI 1640 medium (Thermo Fisher Scientific, CA, USA) containing 10% fetal bovine serum (Thermo Fisher Scientific), 100 U/ml penicillin and 100 μg/ml streptomycin (Thermo Fisher Scientific) at 37°C with 5% CO₂. Cultured glioblastoma U87 cells were transfected with the H4645-plenti-enhanced green fluorescent protein (EGFP)-moesin as described in our previous report (13). The H149 plenti-EGFP empty vector was used as negative control (U87-H149).

Animal care. BALB/c male nude mice (14), 4-6 weeks, 20-25 g, were purchased from the Nanjing Biomedical Research Institute of Nanjing University (Nanjing, P.R. China). All mice were maintained in a HEPA-filtered environment at 24-25°C and humidity was maintained at 50-60%. All animals were fed with autoclaved laboratory rodent diet. Animal experiments were approved by the Animal Committee of Nanjing Origin Biosciences, P.R. China (OB1704).

Orthotopic mouse model of human glioblastoma. An orthotopic mouse model of human glioblastoma was used to assess tumor growth in vivo. The surgical orthotopic implantation (SOI) method followed published procedures (14). U87-GFP, U87-H149, and U87-H4645 cells (5×10⁶) were first subcutaneously injected in the flank of nude mice. The tumors were harvested at the exponential growth phase and resected under aseptic conditions. Strong GFP expression of the tumor tissue was confirmed by fluorescence microscopy. Necrotic tissues were removed and viable tissues were cut with scissors and minced into 1-mm³ fragments. Animals were anesthetized by injection of 0.02 ml 50% ketamine, 38% xylazine, and 12% acepromazine maleate. After proper exposure of the left parietal bone following approximately a 1 cm long incision along the midline of the nude-mouse scalp, a U-shape cut was made on the left parietal bone with a sterile scalpel and blade. The U-shape bone was slightly lifted with a forceps and one 1 mm³ tumor fragment was inserted under the parietal bone. The bone incision was closed with forceps. The skin incision was closed with a 6-0 surgical suture. All procedures of the operation described above were performed under an 8x magnification microscope (Shanghai Precision Instruments, YZ20P5, Shanghai, P.R. China).

In vivo fluorescence imaging. Mice were monitored by real-time non-invasive GFP fluorescence imaging for glioma growth. Tumor volume was calculated using the formula (L × W²) × ½, where W and L represent the perpendicular minor dimension and major dimension, respectively. A fluorescence stereo microscope (MZ650; Nanjing Optic Instrument Inc. P.R. China) equipped with D510 long-pass and HQ600/50 band-pass emission filters (Chroma Technology, Brattleboro, VT, USA) and a cooled color charge-coupled device camera (Qimaging, BC, Canada) was used. Selective excitation of GFP was produced through an illuminator equipped with HQ470/40 and HQ540/40 excitation band-pass filters (Chroma Technology). Images were processed and analyzed with the use of IMAGE PRO PLUS 6.0 software (Media Cybernetics, Silver Spring, MD, USA). At the end of the study, all mice were sacrificed and the tumors were removed, weighed and collected for further analysis.

Isolation of RNA and Reverse transcription-polymer chain reaction (RT-PCR). Total RNA was isolated from tumor tissue with the Trizol reagent (Invitrogen, Carlsbad, California, USA) and reversely transcribed using a PrimeScript RT-PCR kit (Takara, Shimogyo-ku, Kyoto, Japan) according to the manufacturer's instructions, followed by PCR amplification with specific primers. The following primers were used to amplify most of the coding region of moesin (sense, 5’ CAGCATCAAGAACAAGAAAGGC 3’, and antisense, 5’ GGGGAGCATAGAAGACGAAG 3’), β-catenin (sense, 5’ GCCACAAGATTACAAGAAACGG 3’, and antisense, 5’ ATCCACCAGAGTGAAAAGAACG 3’), MMP-2 (sense, 5’ CATCGTAGTTGGCTGTGGTCG 3’, and antisense, 5’GTCTTCCCCTTCACTTTCCTG3’), ICAM1 (sense, 5’TGATGATGACAATCTCATACCG3’, and antisense, 5’AAATTCCCAGCAGACTCCAAT3’), CD44 (sense, 5’TCTGTCTGTGCTGTCGGTGAT3’, and antisense, 5’GCAACCCTACTGATGATGACG3’) and Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (sense, 5’-GCACCGTCAAGGCTGAGAAC-3’ and antisense, 5’-TGGTGAAGACGCCAGTGGA-3’).

Quantitative real-time PCR was performed using a 7300 Real-time PCR system (Applied Biosystems, Waltham, MA, USA). PCR was carried out in a volume of 20 μl containing 10 μl 2×qPCR Master Mix, 2 μl of cDNA, 0.2 μl each primer and 0.4 μl ROX Reference Dye 1. Reaction conditions for amplification of target genes were one cycle of denaturation at 95°C for 5 min, followed by 40 cycles of 5 sec at 95°C, 30 sec annealing at 60°C, and 40 sec prolongation at 72°C. Data were analyzed by the relative standard-curve method and normalized to GAPDH expression. Relative RNA expression in the glioblastoma cell lines was calculated using the 2^−ΔΔCt method. All samples were performed in triplicate.

Western blotting. Protein from tumor tissue was extracted with RIPA buffer (Roche Diagnostics, IN, USA). Protein concentrations were determined by the Bradford assay (Bio-Rad, Hercules, CA, USA). Total proteins were separated by sodium dodecylsulfate–polyacrylamide gel electrophoresis and electrophoretically transferred to a polyvinylidene fluoride membrane (Millipore, Bedford, MA, USA). The membranes were blocked with 5% non-fat milk at room temperature for 1 h and then incubated for 2 h with primary antibodies to moesin, β-catenin, ICAM-1, or β-actin (Cell Signaling Technology, Boston, MA, USA). The membranes were then incubated for 1 h with an appropriate horseradish peroxidase-linked secondary antibody (Santa Cruz Biotechnology, Dallas, TX, USA). Electrochemiluminescence was performed according to the manufacturer's instructions using a ChemiDoc™ Touch Imaging System (Bio-Rad). Quantity One software (Bio-Rad) was used to quantify the density of bands.

Immunohistochemistry. Tumor tissues were fixed in 10% buffered formalin and paraffin-embedded. For immunohistochemistry, sections were incubated with primary antibodies against MMP-2 and CD44 (all from BD Biosciences, San Diego, CA, USA) overnight at 4°C after permeabilization with a solution of 0.1% sodium citrate and 0.1% Triton X-100 and blocking with 10% rabbit serum. After washing with pH 7.4 phosphate-buffered saline (PBS), the sections were incubated with secondary antibody (Dako REAL EnVision Detection System, Dako, Cambridgeshire, UK) for 30 min at room temperature. Color development was performed with 3, 3’-diaminobenzidine (DAB). Nuclei were lightly counter-stained with hematoxylin. The slides were viewed at ×400 magnification, and positive cells were recognized by the appearance of brown staining. The expression level was quantified by the average optical density (AOD) of the positive cells in five fields per sample with ImagePro Plus 6.0 software (Media Cybernetics, Silver Spring, MD, USA).

Statistical analysis. Statistical analysis was performed using SPSS16.0 software (SPSS Inc., Chicago, IL, USA). All results are expressed as mean±SD. Comparisons between two groups were made with the Student's t-test. p<0.05 was considered significant.

• Download figure
• Open in new tab
• Download powerpoint

Figure 1.

Moesin up-regulation in glioblastoma. Moesin expression in orthotopic glioblastoma tumors was analyzed with RT-PCR and western blotting. A: Moesin mRNA expression in U87-GFP-, U87-H149-, and U87-H4645-derived glioblastoma. B: Moesin protein expression in U87-GFP, U87-H149 and U87-H4645 derived glioblastoma. *p<0.01, when compared with untransfected and vector-control group.