Abstract
Background/Aim: The insulin-like growth factor-1 (IGF-1) signaling is well implicated in cancer biology, however the potential roles of the distinct IGF-1 isoforms in human malignancies are largely unknown. Recently, the carboxyl-terminal of the IGF-1Ec variant (hEc; 24aa) has been associated with osteosarcoma and prostate cancer. Herein, we investigated the potential role of hEc in breast cancer. Materials and Methods: Synthetic hEc peptide was administrated to MCF-7 and MDA-MB-231 breast cancer cells. In addition MCF-7 cells were engineered to overexpress hEc. The proliferation and migratory capacities in response to hEc were analyzed using MTT, trypan blue and wound healing/scratch assays, while the activation of the ERK/AKT signaling pathways were investigated using phospho western blotting. Results: We found that exogenous administration of hEc stimulated the proliferation of estrogen-responsive MCF-7, but not that of hormone-resistant MDA-MB-231 cells. In addition, MCF-7 cells stably-overexpressing hEc acquired an increased proliferation rate and migratory capacity, as well as, enhanced ERK1/2 phosphorylation, compared to mock and wild-type cells. Conclusion: hEc stimulates the proliferation and migration of MCF-7 breast cancer cells and enhances the intracellular ERK1/2 signaling.
The insulin-like growth factor-1 (IGF-1) is a key regulator of various cellular events implicated in almost all human physio/pathological processes. The IGF-1 actions are mediated by its transmembrane tyrosine kinase receptor, namely type I IGF receptor (IGF-1R) capable of triggering the intracellular phosphatidylinositol 3-kinase/AKT kinase (PI3K/AKT) and RAF kinase/mitogen activated protein kinase (RAF/MAPK) pathways (1-3). The regulation of the igf1 gene is a complex process employing both transcriptional and post-translational control. Mature IGF-1 is encoded by parts of exons 3 and 4, whereas distinct E domain peptides in the carboxyl terminal are produced by alternative splicing of exons 5 and 6, namely Ea (containing only exon 6), Eb (only exon 5) and Ec (contains parts of exons 5 and 6) (4, 5). All pro-IGF-1 transcripts (IGF-1Ea/IGF-1Eb/IGF-1Ec) encode pro-peptides that after proteolytic cleavage may generate mature IGF-1 and the respective E peptides, (Ea, Eb and Ec). Whether these E peptides possess distinct bio-activities is still debatable.
Over the last two decades the tumor-promoting role of IGF-1 in cancer biology is well-documented and several clinical trials have assessed the clinical use of targeting approaches against the IGF-1 system as a potential anticancer therapy (6-9). However, the putative role of E domain peptides in cancer growth is still unclear. Recent experimental evidence is suggestive for an oncogenic role of human Ec (hEc; 24aa) in prostate cancer and osteosarcoma (10-14). Consequently, we have investigated the potential role of the hEc in human breast cancer cells. Our data indicate that hEc enhance the metabolic activity of wtMDA-MB-231 cells and also induce the proliferation and migration of hEc-overexpressing MCF-7 breast cancer cells. To our knowledge this is the first study addressing the possible oncogenic hEc actions in breast cancer biology, in vitro and further contribute to the notion for a potential role of this molecule in human malignancies.
Materials and Methods
Cloning of hEc peptide. A plasmid containing the CMV promoter and GFP as a transfection monitoring factor, as well as the genes encoding for resistance in kanamycin and neomycin was selected for the overexpression of hEc (pIRES2-EGFP, cat. #6029-1, BD Biosciences, Clontech, Palo Alto, CA, USA). Primers were carefully designed to be complementary to the exact sequence of exon 5 and 6 corresponding to hEc (NCBI Reference Sequence: NG_011713.1) with the addition of the start codon (ATG) and selected restriction enzymes sites (XhoI-EcoRI, F: 5’-GTTTCT-CTCGAGATGTATCAGCCCCCATCTACCA-3’, R: 5’-GTTTCTGAATTCCTACTTGCGTTCTTCAAATGTACT-3’) according to manufacturer's instructions. PCR amplification of hEc was held in cDNA samples obtained from a previously described study (15), in selected cycling conditions (95°C for 3min, 94°C for 30 sec, 58°C for 30 sec, 72°C for 30 sec, 72°C for 2 min, 200C hold, 38 cycles). After verification, PCR product was cloned into the selected plasmid and transformed DH10b e-coli strain. Diagnostic digest and bidirectional sequencing analysis were used for the verification of the construct (Figure 1).
Cell cultures, treatments and stable transfections. The wild-type (wt) human breast cancer cells MCF-7 (estrogen receptor positive; ER+) and MDA-MB-231 (triple-negative; ER-, PGR- and HER2) were purchased from the American Type Culture Collection (ATCC, Bathesda, MD, USA) and cultured in selected medium (EMEM, Lonza, Walkersville, MD, USA) supplemented with 10% fetal bovine serum (FBS, BRL, Eggstein, Germany) and 1% penicillin/streptomycin (GIBCO, Life Technologies, Grand Island, NY, USA) according to ATCC instructions. These cell lines were selected based on the minimal mRNA expression of hEc previously documented (16). Recombinant human IGF-1 (rhIGF-1, Chemicon international Inc., Temecula, CA, USA), commercially-synthesized human Ec (hEc; 24 amino acids at the C-termnial end of human IGF-1Ec) peptide, mouse Ec (mEc; 25 amino acids at the C-terminal end of mouse IGF-1b) and scrambled peptide of 24aa (negative control) were used as treatment factors for 48 h. Concentrations of 3.125, 6.25, 12.5, 25, 50 and 100 nm, were selected based on previous knowledge (17). wtMCF-7 cells were plated at approximately 50% confluence one day prior to transfection with pIRES2-EGFP-hEc construct (MCF-7Ec cells) or empty pIRES2-EGFP vector (mock; mMCF-7 cells) according to the manufacturer's instructions (Lipo 2000, Invitrogen, Carlsbad, CA, USA). Four days after transfection 1000 ng/ml neomycin (G418, Geneticin, Thermo Scientific, Boston, MA, USA) was added to the medium as selective agent, for approximately 4 weeks or until growth of distinct clones was observed. Single clones were picked and grown separately for hEc transfected cells, whereas batch selection was followed for mock cells.
RNA extractions and qPCR. RNA was extracted using the TR-118 reagent (RT-118, Molecular Research Center, Cincinati, OH, USA) according to manufacturer's instructions. Cells were reached at a confluence of 80% before harvesting and following DNAase treatment (Invitrogen, Life Technologies, Grand Island, NY, USA) one microgram (1 μg) of total RNA was reversed transcribed into cDNA using MMULV (Invitrogen, Life Technologies, Grand Island, NY, USA), oligoDT (Fermentas, GmbH, Germany), dNTPs (HT Biotechnology, Cambridge, UK), and 4 U ribonuclease inhibitor (Qiagen, Valencia, CA, USA) according to manufacturer's instructions. Equal amounts of each cDNA (100ng) were further quantified for the expression of Ec, pro-IGF-1Ea and pro-IGF-1Eb as previously described (16), as well as for mature IGF-1 (F: GCTCTTCAGTTCGTGTGTGG, R: TGACTTGGCAGGCTTGA GG), IGF-1R (F: GGGAATGGAGTGCTGTATG, R: CACAGAAGCTTCGTTGAGAA), E-cadherin (F: TGGAGGAATTCTTGCT TTGC, R: CGTACATGTCAGCCAGCTTC), Vimentin (F: GACAATGCGTCTCTGGCACGTCTT, R: TCCTCCGCCTCCTG CAGGTTCTT), N-Cadherin (F: CCACCTACAAAGGCAGAA, R: CCGAGATGGGGTTGATAATG), Cadherin-11 (F: CATGGGCACC ATGAGAAGGGC, R: GCCTGAGCCATCAACGTGTACTG), ERα (F: TGGGCTTACTGACCAACCTG, R: CCTGATCATGGAGGGT CAAA), ERβ (F: AGAGTCCCTGGTGTGAAGCAA, R: GAC AGCGCAGAAGTGAGCATC), GPR-30 (F: TCACGGCCACATTGT CAACCTC, R: GCTGAACCTCACATCTGACTGCTC), AR, (F: ACATCCTGCTCAAGACGCTTCTACC, R: CACTTGCACAGAG ATGATCTCTGCC) and PGR (F: GGGCTACGAAGTCAAACCCA, R: TGTGAGCTCGACACAACTCC), all in the same selected cycling conditions (95°C for 30 s, 95°C for 3 s, 63C for 30 s, for 40 cycles). Verification of each PCR product was accomplished using melting curve analysis, whereas, relative differences in expression levels were presented as fold changes using the comparative Ct method (2−ΔΔCt) and B-actin (F: CCTCGTCTTTGCCGA, R: TGGTGCCTGGGGCG) as the internal control.
Immunofluorescence. MCF-7Ec and mMCF-7 cells were plated in sterilized coverslips at approximately 30-50% confluence one day prior to immunofluorescence (or in microscope slides for immunocytochemistry staining) experiment. Following fixation with 2% paraformaldeyde (PFA) and permeabilization wih absolute methanol, the coverslips were incubated overnight with 1/1,000 polyclonal rabbit anti-human antibody against hEc peptide (18) using 1/2,000 Texas Red (Donkey Anti-Rabbit IgG H&L, Abcam) as secondary, whereas the cell nucleus were stained with DAPI pre-dissolved in anti-fade medium (Slowfade, Gold antifade reagent with DAPI, #S36942 Molecular Probes, USA). Images for all three cell types were analyzed under immunofluorescence microscopy whereas differences in expression of hEc were expressed as differences in density of gray color using the free ImageJ software tool (19).
Immunocytochemistry. The immunocytochemical staining on fixated cell slides (see paragraph above) was performed using the automated Benchmark Ultra platform (Ventana Medical Systems) with the Ultra View DAB detecion kit (Ventana 760-500 a HRP-labeled multimer). Antigen retrieval was performed with Cell Conditioning 1 for 64 min at 95°C. The following monoclonal antibodies against PGR (Ventana, clone 1E2, prediluted) and Ki-67 (DAKO, clone MIB-1, dilution 1:100) were applied in excess. Breast cancer tissue was used as positive control. Furthermore, negative controls were performed by omitting the primary antibody. Nuclear expression was evaluated for both PGR and Ki-67.
Protein extractions and western blots. Total cell protein extracts were obtained following lysis with RIPA buffer (50 μM Tris-HCl, ph:7.5, 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS) containing protease and phosphatase inhibitors (Sigma St. Louis, MO, USA). MCF-7Ec, mMCF-7 and wtMCF7 cells were reached at a confluence of 80% before harvesting. Protein levels were estimated using BCA (Pierce, BCA protein Assay Kit, Prod#23227, Thermo Fisher Scientific, Boston, MA, USA) and equal amounts of proteins (50 μg) undergo SDS-PAGE separation and transference to 0.2 nm PVDF. Membranes incubated overnight with 1/10,000 polyclonal anti-hEc antibody (18), or incubated according to manufacturer's instructions with antibodies against phosphorylated and total AKT (p-AKT, #4060, T-AKT, #9271, Cell Signaling Technology, Inc, USA) or ERK1/2 (p-ERK, #4370, T-ERK, #9102, Cell Signaling Technology, Inc, USA) or ERα (Santa Cruz Biotechnology, Santa Cruz, CA, USA), using anti-human HRP as a secondary and exposed to films using the ECL system (Super Signal West Pico, prod#34080, Thermo Scientific). In all cases differences in band densities expressed as differences in protein levels using the free ImageJ software and Gapdh (GAPDH, sc-32233, Santa Cruz Biotechnology) as an internal control.
Proliferation assays. Following cell counting using Neubauer chamber, equal numbers of cells were plated in appropriate well plates and cultured with selected media supplemented with 10% FBS, as described above. The potential differences in cell proliferation rates between wtMCF-7 cells and mMCF-7 or MCF-7Ec transfectants were estimated both directly or in-directly using different methods in time points of 24 and 48 h (For Ki-67 staining cells plated in microscope slides were used as described above). Direct cell number was extrapolated using the trypan blue exclusion assay, whereas the metabolic activity of cells was estimated after cultivation with 10% MTT (20). In the MTT assays the differences in the metabolic activity induced by the distinct stimuli, were expressed as % percentages above control (untreated). The DNA content of viable cells (adherent) was measured following cell lysis and DNA extraction using the phenol-chlorophorm protocol. The extracted DNA was subjected to photometrical estimation of concentration using the optical density absorbance at 260nm in a nano-drop spectophotometer (Bio-spec nano, Shimadzu, Biotech). Following DNA staining (Cystain, DNA 1 step, #05-5004, Partec, GmbH, Germany) and flow cytometry analysis (Cyflow ML, Partec, GmbH, Germany) the percentages of cell cycle gap phases (G0/G1, G2/M) and/or DNA synthesis phase (S) were estimated automatically using the instrument's software (Flow Max Pro, Partec, GmbH, Germany) for all three cell types.
Wound healing/scratch assay. The MCF-7Ec transfectans, mMCF-7 transfectans and wtMCF-7 cells were analyzed for their migratory potential using the wound healing/scratch assay as described previously (21). One day prior to treatment cell lines were cultivated overnight to serum free medium for cell cycle synchronization. Differences in cell mobility were expressed as differences in the size of the cell-free/scratch area as this measured using the free ImageJ software tool, in time points of 16, 30 and 48 h post the wound. Healing/migratory percentages were estimated compared to t0 of the respective cell type using the formula: 100-(area in t16 or t30 or t48 / area in t0) ×100. Respective p-values were generated comparing the differences in healing in the same time points (16, 30 or 48 h) between the different cell types.
Apoptosis measurement in response to Docetaxel treatment. Rates of early, late apoptosis and necrosis were estimated in wtMCF-7 cells and MCF-7 transfectans (MCF-7Ec and mMCF-7) after the addition of 50 nm of docetaxel (Hospira, UK, Ltd) into the culture medium for 48 h, using the PI-Annexin kit (TACS, Annexin V-FITC, #4830-01-K, Trevigen) according to manufacturer's instructions and flow cytometry analysis (Flow Max Pro, Partec, GmbH, Germany).
Statistical analysis. Experiments were performed in duplicates or triplicates and the final values were averaged and presented as mean±standard deviation (SD). Unpaired student's t-test were used as appropriate and values <0.05 were considered significant.
Results
Administration of hEc induced the metabolic activity of the MCF-7 breast cancer cells. Exogenous administration of human mature IGF-1 (rhIGF-1) in monolayer cultures supplemented with 10% FBS (3.125 nm up to 100 nM), stimulated the growth/metabolic activity of both the ER+ wtMCF-7 (80% at 100 nM; p<0.001) and triple-negative (ER−/PGR−/HER2−) wtMDA-MB-231 (60% at 100 nM) breast cancer cells (Figure 2a and b). The exogenous administration of synthetic hEc also stimulated the growth/metabolic activity of wtMCF-7 cells in monolayer cultures supplemented with 10% FBS (20-42% from 6.25 nM up to 50 nM; p<0.02). Notably, 25 nm or more hEc induced a saturating effect in wtMCF-7 cells while hEc did not stimulate the growth/metabolic rate of the triple-negative wtMDA-MB-231 cells (Figure 2b). In addition, the exogenous administration of either mouse Ec (mEc; a counterpart of hEc generated by the mouse IGF-1Eb transcript; 25 amino acids), or the scrambled peptide did not stimulate either wtMCF-7 or wtMDA-MB-231 cells (Figure 2a and b).
Overexpression of hEc does not alter the expression of the IGF-1 system in MCF-7 cells. Since wtMCF-7 cells responded notably better to hEc treatment we preceded with this cell line in developing an hEc-overexpressing breast cancer model. Following transfection with respective vectors and clonal selection protocols, we tested whether stable transfectants (mock and hEc) have altered expression of several components of the IGF-1 system. Indeed, the expression of the hEc mRNA levels differed substantially among various selected transfectants, some of them exhibited an over-expression for up to 230-fold (p<0.001, Figure 2c). At the protein level, using protein analysis by western blots (WB), we detected a protein band, that corresponded to the expected MW of hEc, being similar to this of positive control (synthetic hEc; 24aa; 3,000 dlts, Figure 2d). The clone 3 (cl3) was selected for characterization and thereafter it was named as MCF-7Ec. Protein analysis, using immunofluorescence (IF), has confirmed the over expression of hEc in this particular clone (MCF-7Ec; 2.8-folds; p<0.05; Figure 2e and f). Furthermore, the over-expression of hEc in MCF-7Ec did not influence the expression of IGF-1, pro-IGF-1Ea and IGF-1R mRNA (Figure 2g-i). The hEc mRNA expression was comparable between the mMCF-7 and wtMCF-7 cells (Figure 2j).
MCF-7Ec cells possessed increased growth and metastatic characteristics. The MCF-7Ec cells grown in monolayer cultures for 2 days under normal conditions (10% serum), comprised of cells with “spicate” edges, resembling to a “spindle-like” phenotype, under reverse phase microscopy (×200 magnification). The morphology of mMCF-7 cells remained comparable to wtMCF-7 cells, presenting a circular/epithelial-like phenotype (Figure 3a).
The autonomous growth/metabolic rate of MCF-7Ec cells was enhanced (MTT assays; 20-40%; p<0.03; 24 h post-plating) as compared to mMCF-7 cells (Figure 3b). Similarly, the proliferation index, as assessed by trypan blue exclusion and DNA content assays, of MCF-7Ec cells was increased (up to 30%; p<0.05) as compared to mMCF-7 and wtMCF-7 cells (Figure 3c and d). However, using flow cytometry we found that the distribution of MCF-7Ec into the S phase was only slightly increased (MCF-7Ec=40.87%±3.25 vs. mMCF-7=32.81%±4.36) as it was the nuclear staining for Ki67 (16 fold) shown by immunocytochemistry (Figure 3e-i).
To test whether the mobility/migration potential of MCF-7 transfectants differ, we employed the wound healing/scratch assay, a methodology that can assess the healing process of damaged (scratched) area, at 16, 30 and 48 h, post-injury/scratch. We found that the scratched area was much faster filled up by MCF-7Ec cells (>30% increase) compared to mMCF-7 and wtMCF-7 cells (MCF-7Ec; 50.44% healing effect; p<0.002 at 16 h and approximately 99% healing effect; p<0.05 at 48 h) (Figure 4a and b). These data indicated that the MCF-7Ec cells have increased motility/migration capability compared to mMCF-7 and wtMCF-7 cells.
Since the IGF-1 signaling has previously been correlated with chemoresistance of breast tumors (22), we aimed to investigate the response of our hEc overexpression model to a widely used chemotherapeutic agent. Although the differences were not significant, we found that MCF-7Ec cells tented to resist relatively better the docetaxel-induced apoptosis, showing a slight increased survival in response to 50 nM docetaxel for 48 h, as compared to docetaxel-induced apoptosis of mMCF-7 cells (MCF-7Ec surviving cells=60.12%±3.89; mMCF-7 surviving cells=53.13%±2.12; Figure 4c).
Phosphorylation of ERK1/2 is induced in MCF-7Ec cells. Since we detected changes in MCF-7Ec morphology and motility/migration capacity, we analyzed the possible differences in expression of indicative markers implicated into the epithelial-to-mesenchymal transition (EMT) phenomenon. The mRNA levels of E-cadherin (e-cdh), vimentin and N-cadherin (N-cdh) were similar between MCF-7Ec and mMCF-7 transfectants (Figure 5a-c). However, we detected an up-regulation (2.1 fold) of cadherin-11 (Cdh-11) mRNA in MCF-7Ec cells (Figure 5d).
In addition, since the crosstalk between the IGF-1/IGF-1R axis and steroid hormones and/or other growth factors has well been described in breast tumors (7), we tested the expression of these molecules in regards to our hEc overexpression model. The expression of androgen receptor (AR) and estrogen receptor β (ERβ) did not present any considerable difference among MCF-7Ec and mMCF-7 cells (Figure 5e and f). Notably, the mRNA expression of progesterone receptor (PGR), ERα and GPR30 (an ER located in the endoplasmatic reticulum), were increased by 2.14, 2.29 and 2.16 fold, respectively (Figure 5g-i). However, we did not observe any noticeable difference in the protein levels of PGR using immunocytochemistry, probably due to the low PGR expression in MCF-7 cells in general (5j). Analysis by western blots confirmed the up-regulation of ERα protein in MCF-7Ec cells (Figure 6a and g). These data suggested that hEc over-expression may influence the expression of estrogen receptors, in vitro.
Previous studies have detected that hEc peptide may induce ERK1/2 phosphorylation without affecting AKT activation (12, 23). Indeed, autonomous basal level phosphorylation rate of ERK1/2 was increased by 2.7 (p<0.05) and 2.2 fold, respectively, in MCF-7Ec transfectants as compared to mMCF-7 cells, while total ERK1/2 levels were comparable (Figure 6a-e). The AKT activation was absent in all the MCF-7 cell types (MCF-7Ec, mMCF-7 and wtMCF-7 cells) (Figure 6a and 6f). Our experimental conditions may account for the inability to identify the basal phosphorylation levels of AKT in any of the three cell types used. However, if the intrinsic AKT signaling was eliminated -for an unknown yet reason- at the time of the experiment, this may explain the small differences observed in survival rates between the different cell lines in response to docetaxel (see above the results section), since the PI3K/AKT pathway is a critical regulator of cell survival and resistance to therapeutics (24).
Discussion
A growing body of experimental evidence has pointed out a distinct role of hEc in several pathophysiological conditions, including cancer (10, 12-15, 23, 25-30). Interestingly, although the proliferative activities of pro-IGF-1Ec peptide are exerted via IGF-1R in experimental breast cancer (31), exogenous hEc may not activate IGF-1R (32). Previous studies have addressed the hEc activities following silencing methods, targeting IGF-1R and insulin receptor (IR), thus suggesting that hEc actions may be mediated via an as yet undiscovered receptor molecule. It was shown that synthetic hEc induced proliferative effects and an ERK1/2-restricted phosphorylation pattern even in the absence of IGF-1R or IR (11, 12, 23, 33). Although the exact molecular mechanism behind the particular bio-regulatory properties of hEc are still not known, these observations point to the distinct bioactivity of this molecule. In accordance with these, herein, we addressed that hEc induces ERK1/2 but not AKT activation, undersigning its discrete actions probably via an IGF-1R-independent manner. Further studies are warranted to investigate this hypothesis and reveal the molecular events governing hEc signaling.
Recently, a tumor-promoting role has been suggested for hEc in prostate cancer and osteosarcoma biology (10, 14). To our knowledge this is the first time that hEc may be associated with an oncogenic role in human breast cancer. Interestingly, the exogenous administration of hEc stimulated the growth of the ER+ wtMCF-7 cells but not this of the (triple negative) wtMDA-MB-231 cells. Notably the mEc, the counterpart of hEc, a product of the IGF-1Eb transcript of mouse igf1, did not stimulate the wtMCF-7 cells and MDA-MB-231 breast cancer cells, suggesting that the amino acid differences between the hEc and mEc may account for distinct biological activities and species specific actions (17). In addition, hEc stimulated the wtMCF-7 cells within a relatively narrow concentration range (6.25-25 nM), presenting saturating effects at higher concentrations. A similar effect was not evident by the exogenous administration of IGF-1 (100 nM). Although hormone-depended breast cancer cells are usually considered to respond to IGF-1 signaling, in our experimental conditions, human IGF-1 (3.125-100 nM) stimulated the growth of both the wtMCF-7 and wtMDA-MB-231 cells in a dose-dependent manner (up to 100 nM), indicating that the IGF-1R is functional in both the wtMCF-7 and wtMDA-MD-231 cells. These data are in compliance with studies addressing that triple negative breast cancer cells may express similar levels of IGF-1R and respond to IGF-1-induced proliferative and survival effects (34). Consequently it is tempting to propose that the preferential actions of hEc peptide may be mediated via an IGF-1R-independent mechanism, corroborating recent data reporting that IGF-1R and insulin receptor (IR) are not activated by exogenous hEc, although the full length IGF-1Ec pro-peptide can activate both IGF-1R and IR in vitro, similarly to mature IGF-1 (32).
In our in vitro model (MCF-7Ec), over-expression of hEc enhanced the proliferation and migration of MCF-7 cells, as well as, the expression of ERα and phosphorylation of ERK1/2, compared to mMCF-7 and wtMCF-7 cells. The latter, along with the preferential stimulation of proliferation in response to exogenous hEc on ER+ wtMCF-7 cells addressed herein, may indirectly suggest the correlation of hEc with estrogens in breast cancer. Although almost 70% of breast cancer cases express ER(α) the development of resistance to anti-estrogen therapy is an inevitable consequence in most of the clinical cases. Several hormone resistant mechanisms implying ERK signaling (35), as well as, re- and/or over-activation the ER(α) through enhanced IGF-1 signaling have been addressed (36, 37) thus, paving the way to the tempting hypothesis that hEc signaling may also be implicated in anti-estrogen-resistant phenotype of breast tumors.
Furthermore, our data showed that Cdh-11, an adhesion molecule belonging to type II cadherins primarily expressed by osteoblasts and bone marrow stromal cells (38), has been preferentially expressed by MCF-7Ec cells. The wtMCF-7 cells are considered negative for Cdh-11 protein expression, presenting a weak mRNA expression (39). The Cdh-11 expression has been previously associated with an aggressive breast cancer cell phenotype and ability for bone metastasis (40). Notably, Cdh-11 can mediate direct cell-cell contact between osteoblasts and/or stromal cells with cancer cells of metastatic potential to bones, particularly in experimental prostate and breast tumors, as well as in Ewing's sarcoma (41-43). Both hEc and Cdh-11 have been previously suggested to be associated with migration mechanisms probably via formation of cell protrusions (44-46). Such formations may account for differences in both migration capacity and morphology observed herein. Taken into consideration the latter along with the up-regulation of the Cdh-11 expression in MCF-7Ec cells, it is conceivable to speculate that hEc may be part of a metastatic process of breast cancer cells. In addition, the notable induction of migration in MCF-7Ec cells along with the notion of up-regulated pERK1/2 levels found herein, are in compliance with studies in bone marrow-derived mesenchymal stem cells and tenocytes addressing formation of actin fillaments and/or increased activity of matrix metalloproteinases-2 (MMP-2), in response to hEc probably via ERK1/2 signaling (45-47). Furthermore, activation of the ERK1/2 signaling pathway has been previously associated with enhanced cell motility properties (48, 49). More thorough approaches are needed to investigate the possible connection between hEc and Cdh-11 expression and their implication to migratory/metastatic capacity of MCF-7Ec breast cancer cells.
Conclusion
Herein we showed that over-expression of hEc enhances the proliferation and migration of MCF-7 breast cancer cells probably via ERK1/2 signaling, alluding to a potential oncogenic role of hEc in ER+ breast cancer cells. Further studies may shed light into the complex mechanisms of disease progression and metastasis and identify hEc as a potential target candidate in breast cancer therapeutics.
Acknowledgements
The Authors are grateful to Dr. Eva Kassi for kindly providing us the ERα antibody.
- Received April 5, 2017.
- Revision received May 5, 2017.
- Accepted May 10, 2017.
- Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved