Skip to main content

Main menu

  • Home
  • Current Issue
  • Archive
  • Info for
    • Authors
    • Editorial Policies
    • Subscribers
    • Advertisers
    • Editorial Board
    • Special Issues
  • Journal Metrics
  • Other Publications
    • In Vivo
    • Cancer Genomics & Proteomics
    • Cancer Diagnosis & Prognosis
  • More
    • IIAR
    • Conferences
    • 2008 Nobel Laureates
  • About Us
    • General Policy
    • Contact
  • Other Publications
    • Anticancer Research
    • In Vivo
    • Cancer Genomics & Proteomics

User menu

  • Register
  • Subscribe
  • My alerts
  • Log in
  • My Cart

Search

  • Advanced search
Anticancer Research
  • Other Publications
    • Anticancer Research
    • In Vivo
    • Cancer Genomics & Proteomics
  • Register
  • Subscribe
  • My alerts
  • Log in
  • My Cart
Anticancer Research

Advanced Search

  • Home
  • Current Issue
  • Archive
  • Info for
    • Authors
    • Editorial Policies
    • Subscribers
    • Advertisers
    • Editorial Board
    • Special Issues
  • Journal Metrics
  • Other Publications
    • In Vivo
    • Cancer Genomics & Proteomics
    • Cancer Diagnosis & Prognosis
  • More
    • IIAR
    • Conferences
    • 2008 Nobel Laureates
  • About Us
    • General Policy
    • Contact
  • Visit us on Facebook
  • Follow us on Linkedin
Research ArticleExperimental Studies

Dynamic Phenotypic Transition of Breast Cancer Cells In Vitro Revealed by Self-floating Cell Culture

YUSUKE OKU, NAOYUKI NISHIYA, KAYOKO TSUDA, MASAHIKO SHIBAZAKI, CHIHAYA MAESAWA and YOSHIMASA UEHARA
Anticancer Research April 2017, 37 (4) 1793-1797;
YUSUKE OKU
1Departments of Integrated Information for Pharmaceutical Sciences, Iwate Medical University School of Pharmacy, Iwate, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: yoku{at}iwate-med.ac.jp
NAOYUKI NISHIYA
1Departments of Integrated Information for Pharmaceutical Sciences, Iwate Medical University School of Pharmacy, Iwate, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
KAYOKO TSUDA
1Departments of Integrated Information for Pharmaceutical Sciences, Iwate Medical University School of Pharmacy, Iwate, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
MASAHIKO SHIBAZAKI
2Department of Tumor Biology, Institute of Biomedical Science, Iwate Medical University, Iwate, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
CHIHAYA MAESAWA
2Department of Tumor Biology, Institute of Biomedical Science, Iwate Medical University, Iwate, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
YOSHIMASA UEHARA
1Departments of Integrated Information for Pharmaceutical Sciences, Iwate Medical University School of Pharmacy, Iwate, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Abstract

Background: Breast tumor heterogeneity leads to phenotypic diversity, such as tumor-initiating and metastatic properties and drug sensitivity. Materials and Methods: We found that a self-floating cell (SFC) culture enriches a drug-resistant subpopulation in a HER2-positive breast cancer cell line. SFCs were analyzed for cancer stem cell markers, gene expression profiles, and sensitivity for anticancer drugs. Results: SFCs expressed cancer stem cell markers, such as aldehyde dehydrogenase (ALDH) activity and elevated HER2 autophosphorylation. Gene expression profiles of SFCs showed a dramatic difference compared to those of parental or forced floating cells. SFCs also expressed CD133, a marker of drug resistance, and resisted cytotoxic drugs by drug efflux transporters. In contrast, HER2 kinase inhibitors efficiently reduced SFC viability. Conclusion: SFCs enrich drug-resistant subpopulations even in vitro and might reflect the highly plastic nature of breast cancer cells even in vitro.

  • Tumor heterogeneity
  • breast cancer
  • HER2
  • drug resistance

Breast tumors are composed of subpopulations that show diverse characteristics in terms of tumor-initiation, metastasis, and drug resistance (1). Recent studies have demonstrated the plastic nature of cancer cells by non-genetic alterations (2). This plasticity seems to confer an evolutionary behavior on cancer cells and makes anticancer therapies complicated. Understanding the mechanisms of breast cancer heterogeneity may lead to sustained therapeutic responses. Simple in vitro models of tumor heterogeneity may reveal mechanistic insights underlying tumor plasticity and provide drug-screening systems for heterogeneity-targeting therapeutics.

A lack of contact inhibition and anchorage-independent proliferation are classical properties of cancer cells that may enrich cancer-initiating cell subsets from a long-term monolayer culture of RB1-deficient mouse fibroblasts (3). Focus in a cancer cell monolayer, that originates from a single cell with focus-initiating ability, is spontaneously shed from the cell sheet and sustains its survival in sphere suspension. This observation suggests that only subpopulations of cells have cancer-initiating properties and are enriched through changes in the microenvironment.

Here we report that a 3D culture system enriches a drug-resistant population with high expression of cancer stem-like cell markers. In our system, referred to as a self-floating cell (SFC) culture, cell aggregates were spontaneously shed from a confluent monolayer of HBC-5 cells, a human breast cancer cell line, and outgrew as spheres. They showed high aldehyde dehydrogenase (ALDH) activity and elevated HER2 signaling, known stem cell markers. SFCs showed altered gene expression profiles compared to that of parental cells. Although they resisted classical chemotherapeutics, suppression of elevated HER2 activity by HER2 tyrosine kinase inhibitors efficiently reduced the proliferation of SFCs. These results suggest that SFC enriches drug-resistant subpopulations and that the dynamic phenotypic transition of SFCs reflects the highly plastic nature of breast cancer cells.

Materials and Methods

Cell culture and chemicals. Adherent HBC-5 cells were grown as cell monolayers in RPMI1640 medium (Sigma, St. Louis, MO, USA) supplemented with 5% heat-inactivated fetal bovine serum (Thermo Fisher Scientific, Waltham, MA, US) with penicillin/streptomycin (Thermo Fisher Scientific). Forced-floating cells (FFCs) were prepared on tissue culture plates were coated with anti-adhesive polymer poly-(2-hydroxyethyl methacrylate) as described elsewhere (4). HBC-5 monolayer cultured cells formed focus when cells reached confluence on the plates. To obtain SFCs, focus forming cells from HBC-5 monolayer culture were detached by gentle pipetting. Detached cells were transferred to a plate containing new medium. This operation was repeated every 2-3 days for approximately 10 times to enrich spheres (about 1 month). Sphere-like cells were usually maintained 3-4 months in the culture medium and used as SFCs. Medium was exchanged twice a week. Doxorubicin, cisplatin, cyclosporin A, and CI1033 were purchased from Sigma. 5-fluorouracil was purchased from Wako. Lapatinib and erlotinib were obtained from Selleck Chemicals (Houston, TX, USA).

Western blot. Western blot was performed as previously described (5). Proteins were separated by SDS-PAGE and blotted onto PVDF membrane (GE Healthcare, Buckinghamshire, UK). The following antibodies were used: 1/1,000 rabbit anti-CD133 antibody (abcam (Cambridge, UK) ab19898), 1/1,000 mouse anti-CD44 antibody (Ancell (Bayport, MN, USA) 352-0201), 1/5,000 mouse anti-tubulin antibody (Sigma B-5-1-2), 1/1,000 rabbit anti-phospho-HER2 Y1221/1222 antibody (Cell Signaling (Danvers, MA, USA) #2243S), rabbit anti-HER2 antibody (Cell Signaling #2165), rabbit anti-phospho-EGFR antibody Y1148 (Cell Signaling, #4404S), rabbit anti-EGFR antibody (Cell Signaling, #2232), 1/5000 anti-mouse IgG-HRP (GE Healthcare), and 1/5,000 anti-rabbit IgG-HRP (GE Healthcare). All antibodies were diluted with CanGetSignal reagent (TOYOBO, Osaka, Japan).

MTT assay. 3×103-104 cells suspended in RPMI-1640 containing 10% FBS were seeded on a well of 96-well plates. Cells were incubated in the presence of drugs for 3 days. 0.5 mg/ml MTT (Sigma) was added and incubated for 4 h. Formazan was solubilized by 8% SDS overnight. OD570 was measured by a microplate reader (Molecular Devices, Sunnyvale, CA, USA).

Flow cytometry. ALDH activity was visualized by ALDEFLUOR reagent (Stemcell Technologies, Vancouver, BC, USA) according to the manufacturer's instructions. Cells were dispersed with Accutase (BD, Franklin Lakes, NJ, USA) and re-suspended in staining buffer. Cells were stained with ALDEFLUOR reagent in the presence or absence of DEAB (ALDH inhibitor) at 37°C for 30 min. Cells were stained with 7-AAD (BD) prior to analysis. Live cells were gated as 7-AAD-negative cells. Cells were analyzed by FACSAria (BD) using FACSDiva software (BD).

RNAseq. For fragment library preparation, a SOLiD total RNA-seq kit (Thermo Fisher Scientific) was used in accordance with the manufacturer's protocol. Sequencing was performed using a SOLiD5500 platform (Thermo Fisher Scientific). Differentially expressed genes in SFCs (more than two fold increase or decrease compared to both parental cells and forced floating cells) were extracted using Avadis NGS software (Strand Genomics, Inc., Hebbal, Bangalore, India).

qPCR. Total RNA were prepared with ISOGEN (Nippon Gene, Tokyo, Japan) and cDNA were synthesized with ReverTra Ace qPCR RT master mix with gDNA remover (TOYOBO). Real-time PCR was performed with QuantiTect SYBR Green PCR Master Mix (Qiagen, Hilden, Germany) using the Eco Real Time PCR system (Illumina, San Diego, CA, USA). Primers for BMP4, DKK1, FST were purchased from Qiagen. The following primers were used for TGFB3 quantification. TGFB3F: AAGAAATCCATAAATTCGACATGATC, TGFB3R: CACATTGAAGCGGAAAACCTT.

Results

Isolation and characterization of self-floating cells from the HBC-5 breast cancer cell line. The HBC-5 breast cancer cell line is a HER2-expressing cell line originally established from a papillotubular adenocarcinoma (6). During cell culture, we noted that cell aggregates were spontaneously shed from the confluent cell culture and grew as spheres on regular tissue culture dishes (Figure 1A). We termed such spheres “self-floating cells” (SFCs). SFCs could be maintained as spheres for at least 4-6 months. The characteristics of SFC cell growth were distinct from those of parental (adherent) cells or those grown on anti-adhesive polymer poly-(2-hydroxyethyl methacrylate) (“forced floating cells,” FFCs) (Figure 1B).

We searched for the characteristic markers of SFCs and found that ALDH activity, a cancer stem-like cell marker in breast cancer, was increased in SFCs (Figure 1C). Overexpression of HER2 in mammary epithelial cells increases the stem-like cell population and the expression of ALDH (7); therefore, we examined the activation status of HER2. Elevated auto-phosphorylation levels in SFCs indicated activated HER2 signaling in them (Figure 1D). These results suggest that the SFCs enrich cell populations with high ALDH activity and activated HER2 signaling. These findings are consistent with higher ALDH activity in HER2-overexpressing cells (7). In addition, we found the increased expression of CD133 in SFCs (Figure 1E), which is a marker for drug resistance in breast cancer (8).

Furthermore, the gene expression profile of SFCs showed a drastic difference from those of adherent cells or FFCs (Figure 1F). Among them, the expression levels of TGFB3, BMP4, FST, and DKK1 were significantly altered in SFCs (Figure 1G). These results showed global changes in gene expression in SFCs, reflecting highly dynamic phenotypic transition even in vitro.

SFCs are resistant to anticancer drugs in a drug efflux transporter-dependent manner. SFCs express CD133, a marker for drug resistance in breast cancer (Figure 1E). Consistent with this, they were tolerant to classical anticancer agents (Figure 2A). We then examined whether the inhibition of ABC transporter activity could reverse drug resistance. We used a pan-ABC transporter inhibitor, cyclosporin A (9). Cyclosporin A alone did not affect the viability of either adherent cells or SFCs; however, their doxorubicin resistance was partially diminished by co-treatment with cyclosporin A (Figure 2B). These results suggest that SFCs are resistant to anticancer drugs, at least in part, in an ABC transporter-dependent manner.

Figure 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 1.

Isolation of self-floating cells expressing stem cell markers from the HBC-5 breast cancer cell line. (A) Emergence of SFCs from HBC-5: i) Schematic diagram of the emergence of SFCs, (ii) representative picture of confluent culture (left), cells forming foci (middle), and spheroid growth of SFCs (right). (B) Growth of SFCs. Growth of adherent cells and FFCs (upper panel) and that of SFCs (lower panel). (C) Expression of ALDH in SFCs. DEAB (an ALDH inhibitor) was used as a negative control. (D) Increase in HER2 auto-phosphorylation in SFCs. FFCs were collected six days after seeding on poly-HEMA-coated plates. SFCs were collected at passages 1, 2, and 3 (p1, p2, p3). (E) Expression of CD133 and CD44 in SFCs. MDA: MDA-MB-231. (F) Global changes in gene expression profiles of SFCs: i) adherent vs. FFC, ii) adherent vs. SFC. (G) Differential expression of components of TGF-β and WNT signaling in SFCs. Data represent mean and standard deviation from triplicate. *p<0.05 by Student's T-test.

Drug-resistant SFCs are highly sensitive to HER2 tyrosine kinase inhibitors. Our results indicate that HER2 signaling is activated in SFCs (Figure 1). On the other hand, inhibition of this signaling in HER2-expressing luminal cancer stem-like cells by trastuzumab impairs their self-renewal (10). Therefore we examined whether the inhibition of this signaling by small molecule kinase inhibitors impairs the growth of SFCs. CI1033 and lapatinib inhibit both EGFR and HER2, and strongly inhibited the cell survival of SFCs (Figure 3A and B). However, erlotinib, an EGFR-specific inhibitor, did not inhibit SFC cell growth (Figure 3C). These results suggest that activation of HER2 signaling plays an important role in the growth of SFCs, and that the addition of the inhibition of HER2 signaling offers a potential therapeutic strategy for heterogeneous tumors containing drug resistant subpopulations.

Discussion

Tumor heterogeneity is generated by genetic and non-genetic changes and makes cancer therapy complicated. In this study, we found an SFC population that enriched a drug-resistant subpopulation of breast cancer cells with stem-like cell markers. Consistent with high ALDH activity, HER2 phosphorylation was elevated in SFCs. SFCs expressed CD133, a predictive marker for drug resistance in breast cancers, and were resistant to classical anticancer drugs, while they were vulnerable to HER2 tyrosine kinase inhibition. These results revealed a dynamic phenotypic transition of breast cancer cells even in vitro. Thus, SFCs may be an in vitro model system for tumor heterogeneity and understanding the mechanisms of the phenotypic transition of breast cancer cells in tumors.

Figure 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 2.

Self-floating cells are resistant to anticancer drugs in a drug efflux transporter-dependent manner. (A) Resistance of SFCs to classical anticancer agents. Data represent mean and standard deviation of triplicates; i) doxorubicin, ii) cisplatin, and iii) 5-FU. (B) Doxorubicin resistance of SFCs was partially reversed by cyclosporin A. Cells were treated with doxorubicin with or without 1 μM cyclosporin A. Data represent mean and standard deviation of triplicates. *p<0.05 by Student's t-test. N.S.: Not statistically significant.

SFCs express stem-like cell markers, and show distinct gene expression profiles including WNT/β-catenin, TGF-β, and BMP4 signaling components (Figure 1). Their differential expressions are associated with malignant phenotypes in breast cancer (11-14). Differentiated tumor cells can also dedifferentiate into cancer stem cells without genetic changes (2). SFCs may represent a subpopulation with nongenetic alterations or one with rare mutations in the HBC-5 cell line. SFCs may be useful for discovering the molecular cues triggering phenotypic changes.

SFCs are resistant to classical anticancer agents (Figure 2A). Drug resistance was reversed by cyclosporin A, a pan-ABC transporter inhibitor (Figure 2B). Consistent with drug resistance, they also expressed CD133, a putative drug resistance marker in breast cancers (Figure 1E). Side-population cells are drug resistant and express ABC transporters, leading to poor responses or relapse after intensive chemotherapy (15). Drug resistance mediated by ABC transporters can be canceled by cyclosporin A or other drugs (16). Together with the changes in marker expression and transcriptional profile, a subpopulation of cells with altered drug sensitivity may be selected by changes in the microenvironment. Although SFCs are resistant to classical anticancer drugs, our findings indicate they become sensitive to anti-HER2 therapy (Figure 3). Auto-phosphorylation of HER2 is elevated in SFCs, consistent with high ALDH activity (Figure 1D). Other targets for drug resistant subpopulations of breast cancer cell lines may be discovered using chemical or genetic screening with the SFC system or their gene-expressing profiles. From another point of view, our results demonstrated that an anti-HER2 therapy-sensitive subpopulation was selected by the SFC culture. Breast tumors contain HER2-expressing subpopulations and this subpopulation exhibits CSC-like phenotypes. Trastuzumab can inhibit their CSC-like properties (10). Heterogeneous expression of HER2 in HER2 amplification-negative breast cancer is associated with poor prognosis (17). Indeed a population of patients with low HER2 still benefits from trastuzumab (18). Given that SFCs are drug-resistant and anti-HER2 therapy-sensitive, our results further support the usefulness of combination or sequential therapy using anti-HER2 drugs and classical anticancer drugs even for HER2-low breast cancers, which is under clinical trial (ClinicalTrial.gov Identifier: NCT01275677).

Figure 3.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 3.

Self-floating cells are highly dependent on HER2 activation. SFCs were highly sensitive to the inhibition of HER2 by small-molecule inhibitors. Data represent mean and standard deviation of three independent experiments. (A) CI1033 (pan-ErbB inhibitor), (B) lapatinib (EGFR, HER2 inhibitor), and (C) erlotinib (EGFR-specific inhibitor).

In summary, we showed the dynamic phenotypic transition of SFCs in vitro. SFCs may become a useful tool for understanding the mechanisms of phenotypic change in tumors and for discovering therapeutic options for targeting drug-resistant subpopulations.

Acknowledgements

The Authors would like to thank Dr. Takao Yamori for providing cell lines and the Screening Committee of Anticancer Drugs supported by a Grant-in-Aid for Scientific Research on Innovative Areas, Scientific Support Programs for Cancer Research, from The Ministry of Education, Culture, Sports, Science and Technology, Japan for providing the SCADS inhibitor kits. We also thank Shuhei Sugiyama, Chie Ishikawa, and Emi Takahashi for technical assistance. This work was supported by a Grant-in-Aid for the Strategic Medical Science Research Center from MEXT Japan 2010-2014, JSPS KAKENHI Grant Number JP23501310, and in part by JSPS KAKENHI Grant Number JP26830113.

Footnotes

  • ↵* These authors contributed equally to this study.

  • Received January 27, 2017.
  • Revision received March 13, 2017.
  • Accepted March 14, 2017.
  • Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved

References

  1. ↵
    1. Koren S,
    2. Bentires-Alj M
    : Breast Tumor Heterogeneity: Source of Fitness, Hurdle for Therapy. Mol Cell 60: 537-546, 2015.
    OpenUrlCrossRef
  2. ↵
    1. Chaffer CL,
    2. Brueckmann I,
    3. Scheel C,
    4. Kaestli AJ,
    5. Wiggins PA,
    6. Rodrigues LO,
    7. Brooks M,
    8. Reinhardt F,
    9. Su Y,
    10. Polyak K,
    11. Arendt LM,
    12. Kuperwasser C,
    13. Bierie B,
    14. Weinberg RA
    : Normal and neoplastic nonstem cells can spontaneously convert to a stem-like state. Proc Natl Acad Sci USA 108: 7950-7955, 2011.
    OpenUrlAbstract/FREE Full Text
  3. ↵
    1. Liu Y,
    2. Clem B,
    3. Zuba-Surma EK,
    4. El-Naggar S,
    5. Telang S,
    6. Jenson AB,
    7. Wang Y,
    8. Shao H,
    9. Ratajczak MZ,
    10. Chesney J,
    11. Dean DC
    : Mouse fibroblasts lacking RB1 function form spheres and undergo reprogramming to a cancer stem cell phenotype. Cell Stem Cell 4: 336-347, 2009.
    OpenUrlCrossRefPubMed
  4. ↵
    1. Igarashi Y,
    2. Ootsu K,
    3. Onaka H,
    4. Fujita T,
    5. Uehara Y,
    6. Furumai T
    : Anicemycin, a new inhibitor of anchorage-independent growth of tumor cells from Streptomyces sp TP-A0648. J Antibiot 58: 322-326, 2005.
    OpenUrlCrossRefPubMed
  5. ↵
    1. Oku Y,
    2. Nishiya N,
    3. Shito T,
    4. Yamamoto R,
    5. Yamamoto Y,
    6. Oyama C,
    7. Uehara Y
    : Small molecules inhibiting the nuclear localization of YAP/TAZ for chemotherapeutics and chemosensitizers against breast cancers. FEBS Open Bio 5: 542-549, 2015.
    OpenUrlCrossRefPubMed
  6. ↵
    1. Shimo A,
    2. Tanikawa C,
    3. Nishidate T,
    4. Lin ML,
    5. Matsuda K,
    6. Park JH,
    7. Ueki T,
    8. Ohta T,
    9. Hirata K,
    10. Fukuda M,
    11. Nakamura Y,
    12. Katagiri T
    : Involvement of kinesin family member 2C/mitotic centromere-associated kinesin overexpression in mammary carcinogenesis. Cancer Sci 99: 62-70, 2008.
    OpenUrlPubMed
  7. ↵
    1. Korkaya H,
    2. Paulson A,
    3. Iovino F,
    4. Wicha MS
    : HER2 regulates the mammary stem/progenitor cell population driving tumorigenesis and invasion. Oncogene 27: 6120-6130, 2008.
    OpenUrlCrossRefPubMed
  8. ↵
    1. Sansone P,
    2. Ceccarelli C,
    3. Berishaj M,
    4. Chang Q,
    5. Rajasekhar VK,
    6. Perna F,
    7. Bowman RL,
    8. Vidone M,
    9. Daly L,
    10. Nnoli J,
    11. Santini D,
    12. Taffurelli M,
    13. Shih NNC,
    14. Feldman M,
    15. Mao JJ,
    16. Colameco C,
    17. Chen J,
    18. DeMichele A,
    19. Fabbri N,
    20. Healey JH,
    21. Cricca M,
    22. Gasparre G,
    23. Lyden D,
    24. Bonafe M,
    25. Bromberg J
    : Self-renewal of CD133(hi) cells by IL6/Notch3 signalling regulates endocrine resistance in metastatic breast cancer. Nat Commun 7: 10442, 2016.
    OpenUrlPubMed
  9. ↵
    1. Karthikeyan S,
    2. Hoti SL
    : Development of Fourth Generation ABC Inhibitors from Natural Products: A Novel Approach to Overcome Cancer Multidrug Resistance. Anti-Cancer Agent Med Chem 15: 605-615, 2015.
    OpenUrl
  10. ↵
    1. Ithimakin S,
    2. Day KC,
    3. Malik F,
    4. Zen Q,
    5. Dawsey SJ,
    6. Bersano-Begey TF,
    7. Quraishi AA,
    8. Ignatoski KW,
    9. Daignault S,
    10. Davis A,
    11. Hall CL,
    12. Palanisamy N,
    13. Heath AN,
    14. Tawakkol N,
    15. Luther TK,
    16. Clouthier SG,
    17. Chadwick WA,
    18. Day ML,
    19. Kleer CG,
    20. Thomas DG,
    21. Hayes DF,
    22. Korkaya H,
    23. Wicha MS
    : HER2 drives luminal breast cancer stem cells in the absence of HER2 amplification: implications for efficacy of adjuvant trastuzumab. Cancer Res 73: 1635-1646, 2013.
    OpenUrlAbstract/FREE Full Text
  11. ↵
    1. Eterno V,
    2. Zambelli A,
    3. Villani L,
    4. Tuscano A,
    5. Manera S,
    6. Spitaleri A,
    7. Pavesi L,
    8. Amato A
    : AurkA controls self-renewal of breast cancer-initiating cells promoting wnt3a stabilization through suppression of miR-128. Sci Rep-Uk 6: 28436, 2016.
    OpenUrl
    1. Kudo-Saito C,
    2. Fuwa T,
    3. Murakami K,
    4. Kawakami Y
    : Targeting FSTL1 prevents tumor bone metastasis and consequent immune dysfunction. Cancer Res 73: 6185-6193, 2013.
    OpenUrlAbstract/FREE Full Text
    1. Mariz K,
    2. Ingolf JB,
    3. Daniel H,
    4. Teresa NJ,
    5. Erich-Franz S
    : The Wnt inhibitor dickkopf-1: a link between breast cancer and bone metastases. Clin Exp Metastasis 32: 857-866, 2015.
    OpenUrl
  12. ↵
    1. Ampuja M,
    2. Alarmo EL,
    3. Owens P,
    4. Havunen R,
    5. Gorska AE,
    6. Moses HL,
    7. Kallioniemi A
    : The impact of bone morphogenetic protein 4 (BMP4) on breast cancer metastasis in a mouse xenograft model. Cancer Lett 375: 238-244, 2016.
    OpenUrl
  13. ↵
    1. Marusyk A,
    2. Polyak K
    : Tumor heterogeneity: causes and consequences. Biochim Biophys Acta 1805: 105-117, 2010.
    OpenUrlPubMed
  14. ↵
    1. Videira M,
    2. Reis RL,
    3. Brito MA
    : Deconstructing breast cancer cell biology and the mechanisms of multidrug resistance. Biochim Biophys Acta 1846: 312-325, 2014.
    OpenUrl
  15. ↵
    1. Kurozumi S,
    2. Padilla M,
    3. Kurosumi M,
    4. Matsumoto H,
    5. Inoue K,
    6. Horiguchi J,
    7. Takeyoshi I,
    8. Oyama T,
    9. Ranger-Moore J,
    10. Allred DC,
    11. Dennis E,
    12. Nitta H
    : HER2 intratumoral heterogeneity analyses by concurrent HER2 gene and protein assessment for the prognosis of HER2 negative invasive breast cancer patients. Breast Cancer Res Treat 158: 99-111, 2016.
    OpenUrl
  16. ↵
    1. Paik S,
    2. Kim C,
    3. Wolmark N
    : HER2 status and benefit from adjuvant trastuzumab in breast cancer. N Engl J Med 358: 1409-1411, 2008.
    OpenUrlCrossRefPubMed
PreviousNext
Back to top

In this issue

Anticancer Research
Vol. 37, Issue 4
April 2017
  • Table of Contents
  • Table of Contents (PDF)
  • Index by author
  • Back Matter (PDF)
  • Ed Board (PDF)
  • Front Matter (PDF)
Print
Download PDF
Article Alerts
Sign In to Email Alerts with your Email Address
Email Article

Thank you for your interest in spreading the word on Anticancer Research.

NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.

Enter multiple addresses on separate lines or separate them with commas.
Dynamic Phenotypic Transition of Breast Cancer Cells In Vitro Revealed by Self-floating Cell Culture
(Your Name) has sent you a message from Anticancer Research
(Your Name) thought you would like to see the Anticancer Research web site.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
9 + 0 =
Solve this simple math problem and enter the result. E.g. for 1+3, enter 4.
Citation Tools
Dynamic Phenotypic Transition of Breast Cancer Cells In Vitro Revealed by Self-floating Cell Culture
YUSUKE OKU, NAOYUKI NISHIYA, KAYOKO TSUDA, MASAHIKO SHIBAZAKI, CHIHAYA MAESAWA, YOSHIMASA UEHARA
Anticancer Research Apr 2017, 37 (4) 1793-1797;

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Reprints and Permissions
Share
Dynamic Phenotypic Transition of Breast Cancer Cells In Vitro Revealed by Self-floating Cell Culture
YUSUKE OKU, NAOYUKI NISHIYA, KAYOKO TSUDA, MASAHIKO SHIBAZAKI, CHIHAYA MAESAWA, YOSHIMASA UEHARA
Anticancer Research Apr 2017, 37 (4) 1793-1797;
Twitter logo Facebook logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • Materials and Methods
    • Results
    • Discussion
    • Acknowledgements
    • Footnotes
    • References
  • Figures & Data
  • Info & Metrics
  • PDF

Related Articles

Cited By...

  • No citing articles found.
  • Google Scholar

More in this TOC Section

  • Targeted Sensitization of Leukemic T-cells to Anticancer Drugs by SIRT1 Agonist SRT-1720
  • Alteration of Flavin Homeostasis in Uterine Cancer
  • Prognostic Significance of PPFIA2 in Localized Prostate Cancer: Integrative Analysis and Functional Validation
Show more Experimental Studies

Keywords

  • tumor heterogeneity
  • Breast cancer
  • HER2
  • drug resistance
Anticancer Research

© 2026 Anticancer Research

Powered by HighWire