Abstract
Hedgehog signaling is activated in pancreatic cancer and could be a therapeutic target. We previously demonstrated that recombination signal binding protein for immunoglobulin-kappa-J region (RBPJ) and mastermind-like 3 (MAML3) contribute to the hypoxia-induced up-regulation of Smoothened (SMO) transcription. We have also shown that protein-bound polysaccharide-K (PSK) could be effective for refractory pancreatic cancer that down-regulates SMO transcription under hypoxia. In this study, we evaluated whether the anticancer mechanism of PSK involves inhibiting RBPJ and MAML3 expression under hypoxia. PSK reduced SMO, MAML3 and RBPJ expression in pancreatic cancer cells under hypoxia. PSK also blocked RBPJ-induced invasiveness under hypoxia by inhibiting matrix metalloproteinase expression. Lastly, we showed that PSK attenuated RBPJ-induced proliferation both in vitro and in vivo. These results suggest that PSK suppresses Hedgehog signaling through down-regulation of MAML3 and RBPJ transcription under hypoxia, inhibiting the induction of a malignant phenotype in pancreatic cancer. Our results may lead to development of new treatments for refractory pancreatic cancer using PSK as a Hedgehog inhibitor.
Patients with pancreatic cancer have an extremely poor prognosis and standard therapies are generally ineffective. The development of new effective therapeutic strategies for pancreatic cancer is needed. Hedgehog (Hh) signaling is activated in pancreatic cancer and involved in producing the malignant phenotype that includes increased proliferation and invasiveness (1-3). We previously demonstrated the possibility of using Hh inhibitors as anticancer therapies for pancreatic cancer (4, 5). Although various Smoothened (SMO) inhibitors have been developed, their effectiveness against pancreatic cancer in clinical trials has not been reported (6).
Increased attention has recently been given to understanding the roles of the tumor microenvironment, hypoxia in cancer development and responses to treatment. Hh signaling has been shown to be activated under hypoxic conditions via the up-regulation of SMO transcription (7, 8). We previously showed that blocking SMO transcription may be significantly more effective than inhibiting SMO protein (9). Taken together, establishing a means of suppressing the transcriptional up-regulation of SMO under hypoxia may be important for improving the effectiveness of Hh inhibitors and the development of new therapeutic strategies against pancreatic cancer.
Polysaccharide-K (PSK), a protein-bound polysaccharide, was developed in Japan and has been shown to be effective in combination with a variety of chemotherapeutic agents in clinical trials (10-13). PSK can suppress TGFβ1, matrix metalloproteinases (MMPs), p38 mitogen-activated protein kinase pathway activation and activated-signal transducers and activator of transcription-3 inhibiting cell invasiveness and inducing apoptosis (14-16). In addition, it was shown that PSK enhances docetaxel chemosensitivity through nuclear factor-kappa B activation in pancreatic cancer (17). Previously, we reported that PSK reduces hypoxia-induced SMO transcription (18). We also showed that recombination signal binding protein for immunoglobulin-kappa-J region (RBPJ) and mastermind-like 3 (MAML3) contribute to the hypoxia-induced up-regulation of SMO transcription (19). In this study, we investigated whether PSK contributes to the inhibition of RBPJ and MAML3 expression under hypoxia to develop a new therapeutic strategy for pancreatic cancer.
Materials and Methods
Cell culture and reagents. Two human pancreatic ductal adenocarcinoma cells (PDAC) lines (SUIT-2 and Panc-1) were maintained in RPMI-1640 medium (Nacalai Tesque, Kyoto, Japan) supplemented with 10% fetal calf serum (FCS; Life Technologies Grand Island, NY, USA), USA and antibiotics (100 units/ml of penicillin and 100 μg/ml of streptomycin). For hypoxic conditions, cells were cultured in 1% O2, 5% CO2, and 94% N2 using a multigas incubator (Sanyo, Tokyo, Japan). PSK (100 μg/ml) was added to the culture and then, cell numbers were counted by light microscopy at the indicated days. PSK was kindly provided from KUREHA Co. Ltd.
Matrigel invasion assay. The invasiveness of pancreatic cancer cells was assessed based on the invasion of cells through Matrigel-coated transwell inserts, as described previously (7). In brief, the upper surface of a filter (pore size, 8.0 μm; BD Biosciences, Heidelberg, Germany) was coated with basement membrane Matrigel (BD Biosciences). Cells were suspended in RPMI-1640 with 10% FBS. Then 0.8×105 cells were added to the upper chamber and incubated for 16 h under hypoxia. After incubation, the filters were fixed and stained with Diff-Quick reagent (International Reagents, Kobe, Japan). All cells that had migrated from the upper to the lower side of the filter were counted under a light microscope (BX50; Olympus, Tokyo, Japan). Tumor cell invasiveness testing was carried out in triplicate wells.
Plasmid. Plasmids pFN21A HaloTag CMV Flexi-RBPJ vector and pFN21AB5901 control empty vector were purchased from Promega (Madison, WI, USA). Cells (0.2×106 cells/well) seeded in 6-well plates were transfected with 2.5 μg plasmids under normoxia using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. One day after transfection under normoxia, transfected PDAC were cultured with or without 100 μg/ml PSK for 2 days under hypoxia and mRNA and protein levels were estimated. In the invasion assay, after transfection, PDAC cells were cultured with or without 100 μg/ml PSK for 16 h under hypoxia. In the proliferation assay, after transfection, PDAC were cultured with or without 100 μg/ml PSK under hypoxia, and cell number was counted at intervals.
Real time polymerase chain reaction (PCR). Total RNA was extracted from wild-type PDAC with or without 100 μg/ml PSK, and control plasmid- or RBPJ plasmid-transfected PDAC with or without 100 μg/ml PSK using the High Pure RNA Isolation Kit (Roche, Mannheim, Germany), and quantified by spectrophotometry (Ultrospec 2100 Pro; Amersham Pharmacia Biotech, Cambridge, UK). For real-time RT-PCR, 1 μg of RNA was treated with DNase and reverse transcribed to cDNA with the Quantitect Reverse Transcription Kit (Qiagen, Valencia, CA, USA) according to the manufacturer's protocol. Reactions were run with iQ™ SYBR Green Supermix (Bio-Rad), on a DNA Engine Option 2 System (MJ Research, Waltham, MA, USA). All primer sets amplified fragments less than 200 bp long. The primer sequences used were as follows: SMO, forward: CAGGTGGATGGGGACTCTGTGAGT, reverse: GAGTCATGACTCCTCGGATGAGG; MAML3, forward: 5’-AAGCCCAGGGACCGAGGCAA-3’, reverse: 5’-GCAGCCTTGGAGGGGCTTGG-3’; RBPJ, forward: 5’-CGCATTATTGGATGCAGATG-3’, reverse: 5’-CAGGAAGCGCCATCATTTAT-3’; matrix metalloproteinase (MMP9), forward: 5’-TGGGCTACGTGACCTATGACAT-3’, reverse: 5’-GCCCAGCCCACCTCCACTCCTC-3’; MMP2, forward: 5’-TGATCTTGACCAGAATACCATCGA-3’, reverse: 5’-GGCTTGCGAGGGAAGAAGTT-3’; E-cadherin (CDH1), forward: 5’-GAACAGCACGTACACAGCCCT-3’, reverse: 5’-GCAGAAGTGTCCCTGTTCCAG-3’, and β-actin (ACTB) forward: 5’-TTGCCGACAGGATGCAGAAGGA-3’, and reverse: 5’-AGGTGGACAGCGAGGCCAGGAT-3’. The amount of each target gene in a given sample was normalized to the level of β-actin.
Immunoblotting. Whole-cell extraction was performed with M-PER Reagents (Pierce Biotechnology, Rockford, IL, USA) according to the manufacturer's instructions. Protein concentration was determined with Bio-Rad Protein Assay (Bio-Rad, Hercules, CA, USA), and protein samples (50 μg) were separated by electrophoresis on an sodium dodecyl sulfate-polyacrylamide gel and transferred to Protran nitrocellulose membranes (Whatman GmbH, Dassel, Germany). Blots were then incubated with anti-SMO (1:200, sc-13943; Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti-MAML3 (1:100, sc-82220; Santa Cruz Biotechnology), anti-RBPJ (1:100, sc-8213; Santa Cruz Biotechnology), anti-MMP2 (1:100, sc-10736; Santa Cruz Biotechnology), anti-MMP9 (1:100, sc-6840; Santa Cruz Biotechnology) and anti-α-tubulin (1:1000; Sigma Aldrich Co., St. Louis, MO, USA) overnight at 4°C. Blots were then incubated with the appropriate horseradish peroxidase-linked secondary antibody (Amersham Biosciences, Piscataway, NJ, USA) at room temperature for 1 hour. Immunocomplexes were detected with ECL plus Western Blotting Detection System (Amersham Biosciences) and visualized with a Molecular Imager FX (Bio-Rad). We used α-tubulin as a protein loading control.
In vivo xenograft tumor model. SUIT-2 cells (0.5×106 cells) transfected with RBPJ plasmid or control empty plasmid in 50 μl RPMI medium were subcutaneously injected into three BALB/c female nude mice (5 weeks old) in each group. All animals were obtained from The Charles River Laboratory (Wilmington, MA, USA) and maintained in standard conditions according to institutional guidelines. These animal experiments were approved by the Ethics Committee of Kyushu University (A27-004-0). Primary tumor size was measured every 4-5 days with calipers; approximate tumor weights were determined using the formula 0.5ab2, where a is the larger and b is the smaller of the two perpendicular diameters.
PSK dosage was determined by reference to the previous study (10). PSK (6 mg/mouse) was intraperitoneally injected twice a week. No toxic side-effect was observed in any mice by inspection.
Statistical analysis. The data are presented as the means±standard deviation (SD). Student's t-tests were used to compare continuous variables between two groups throughout this study using Microsoft Excel software (Microsoft Corp., Redmond, WA, USA). p-Values of <0.05 were considered as statistically significant.
Results
PSK reduces MAML3 and RBPJ expression in PDAC cells under hypoxia. RBPJ, MAML3 and SMO expression was measured by real-time PCR and western blotting in PSK-treated cells under hypoxia, and the data showed that in all three cases, expression significantly decreased in PSK-treated cells compared with control cells also grown in low oxygen (Figure 1A and B). Next, an RBPJ expression plasmid was transfected into the cells, and RBPJ and SMO mRNA and protein levels were found increased compared to control-transfected cells. PSK suppressed RBPJ and SMO mRNA and protein expression in RBPJ-transfected cells (Figure 1C and D). These results suggest that PSK reduces MAML3 and RBPJ expression in PDAC under hypoxic conditions.
PSK blocks RBPJ-induced invasiveness under hypoxia through MMP inhibition. We have previously shown that PSK blocks invasiveness by inhibiting SMO transcription (10) and that RBPJ contributes to SMO transcription under hypoxia (19). Here we analyzed whether RBPJ regulation contributes to the decreased invasiveness of PSK-treated cells. Invasiveness of RBPJ-transfected cells was significantly higher than in control cells, and PSK treatment blocked RBPJ-induced invasiveness (Figure 2A). We have also shown that MMPs contribute to Hh signaling-induced invasiveness in PDAC (4, 7). Therefore, we next investigated whether MMPs are involved in RBPJ-induced invasiveness. Interestingly, MMP2 was shown to contribute to the invasiveness of SUIT-2 cells, and MMP9 is involved in the invasiveness of Panc-1 cells (Figure 2B and C). On the other hand, there were no significant changes in E-cadherin expression in any of the treatment groups, suggesting that endothelial–mesenchymal transition (EMT) might not contribute to that invasiveness (Figure 2B and C).
PSK attenuates RBPJ-induced proliferation both in vitro and in vivo. Increased proliferation and invasion are two of the malignant phenotypes of pancreatic cancer. We have previously demonstrated that PSK reduces the proliferative rate of pancreatic cancer cells by inhibiting SMO transcription (10). Here, we analyzed whether RBPJ regulation contributes to the decreased proliferation of PSK-treated cells. The proliferation rate of RBPJ-transfected cells was significantly higher than that of control cells, and PSK blocked RBPJ-induced proliferation in vitro (Figure 3A).
Next, we confirmed these in vitro results using a mouse model. Tumor volumes from mice subcutaneously injected with RBPJ-transfected SUIT-2 cells were significantly higher than those from mice injected with SUIT-2 cells transfected with the control empty plasmid (Figure 3B). As expected, PSK attenuated RBPJ-induced proliferation in vivo, approximately to the same level as control cells (Figure 3B). These results suggest that PSK blocks RBPJ-induced proliferation both in vitro and in vivo.
Discussion
In this study, exogenous RBPJ overexpression using an RBPJ expression plasmid did not induce major phenotypic differences in PDAC. This may be because RBPJ is sufficiently expressed in PDAC to induce biological effects. However, as shown in a previous study, suppressing RBPJ dramatically reduced proliferation and invasion in PDAC (19). We therefore conclude that RBPJ expression significantly influences malignant phenotypes in PDAC.
Interestingly, RBPJ and MAML3 are also known activators of NOTCH signaling, which like Hh signaling, is involved in embryonic morphogenesis. It has been shown that hypoxia activates NOTCH signaling through hypoxia-inducible factor 1α (HIF1α) activation (20-21). Qiang et al. revealed that HIF1α mediates hypoxia-mediated maintenance of glioblastoma stem cells through NOTCH activation (22). However, our preliminary results suggested that HIF1α was not involved in inducing the expression of SMO, glioma-associated oncogene1 (GLI1), RBPJ and MAML3 (7, 19). Further research into the relationships among RBPJ, MAML3 and HIF1α is required to fully understand the mechanism underlying the hypoxia-induced activation of NOTCH signaling. However, because PSK can inhibit the expression of SMO, RBPJ and MAML3, it may have value as a pan-inhibitor of the reactivated morphogenic signaling pathways in malignant pancreatic tumors.
As previously described, PSK suppresses both HIF1α and SMO expression (10). PSK is a polysaccharide, not a purified single material, and is difficult to separate into a single species. It is, therefore, unclear which component molecule in PSK contributes to the repression of MAML3 and RBPJ expression. In a previous study, PSK was divided into two fractions: ≤10,000 normal molecular weight limit (NMWL, low components) and ≥10,000 NMWL (high components). Both components were found to inhibit Hh signaling; the high component fraction also reduced HIF1α expression (18). The molecular weight of RBPJ is 56 kDa and the molecular weight of MAML3 is 150-170 kDa. Consistent with a previous study of ours (18), both RBPJ and MAML3 may inhibit Hh and HIF1α signaling.
MMPs and EMT are thought to be important factors in cancer invasion and metastasis. The expression of MMPs correlated with RBPJ-induced invasiveness in this study. Interestingly, MMP2 expression regulates invasiveness in ASPC-1 and SUIT-2 cells (19), while MMP9 expression is paramount for an invasive phenotype in Panc-1 cells (Figure 2B and C). It is likely that different MMPs regulate invasiveness in different cell types. Some studies have shown that Hh and NOTCH signaling induces an invasive phenotype through EMT in PDAC (8, 23). However, the effects of EMT are not likely to have contributed to the RBPJ-induced invasiveness and subsequent PSK-induced inhibition of invasiveness in this study as assessed by E-cadherin expression (Figure 2B).
Figure 4 shows a schematic conclusion from the present study based on our previous findings. Hh signaling is activated through the up-regulation of SMO transcription under hypoxic conditions, inducing a malignant phenotype in PDAC (7). RBPJ and MAML3 contribute to the up-regulation of SMO under hypoxia (19). In the present study, we demonstrated that PSK reduces MAML3 and RBPJ expression under hypoxia, inhibiting SMO transcription and suppressing the malignant phenotype of PDAC cells. This mechanism underlies the antitumor effects of PSK against PDAC. Our results may lead to development of new treatment strategies for refractory pancreatic cancer using Hh inhibitors.
Acknowledgements
This study was supported by JSPS KAKENHI Grant Number 26293289 and KUREHA Co. Ltd. We thank Ms Kaori Nomiyama for skillful technical assistance.
Footnotes
↵* These authors contributed equally to this study.
Conflicts of Interest
All Authors declare no conflict of interest in regard to this study.
- Received May 6, 2016.
- Revision received June 8, 2016.
- Accepted June 9, 2016.
- Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved