Decreased Expression of Tumor-suppressor Gene LKB1 Correlates with Poor Prognosis in Human Gastric Cancer

Materials and Methods

Cell culture. Human gastric cancer cell lines NCI-N87, MKN-28, BGC-823 and MKN-45 were purchased from the Cell Resource Center of the Shanghai Life Sciences Institute, Chinese Academy of Sciences (Shanghai, China). NCI-N87 and MKN-28 are well-differentiated cell lines, while BGC-823 and MKN-45 are poorly differentiated cell lines. The immortalized normal gastric mucosal epithelial cell line GES-1 was kindly provided by the Jiangsu Institute of Pharmaceutical Research (Nanjing, China). The cells were cultured in RPMI-1640 medium (GIBCO Life Technologies, Grand Island, NY, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (GIBCO) in a humidified incubator with an atmosphere of 5% CO₂ at 37°C.

Patients and specimens. A total of 155 formalin-fixed, paraffin-embedded gastric-cancer specimens were obtained from patients who underwent gastric resection from January 2008 to December 2009 at the Affiliated Cancer Hospital of Nanjing Medical University, Nanjing, China. All specimens were confirmed histologically, independently by two pathologists. All patients received post-operative conventional radiotherapy and chemotherapy. Ninety-five normal gastric epithelial tissue specimens from patients without gastric cancer were selected for control. Clinico-pathological data were reviewed and are listed in Table I. Tumor–node–metastasis (TNM) staging was based on the criteria of the American Joint Committee on Cancer (AJCC; fifth edition) (17). Patients were followed up, and overall survival (OS) time was recorded. All studies were approved by the Human Ethics Committee of the Affiliated Cancer Hospital of Nanjing Medical University (OR1315) and written informed consent was obtained from all patients.

Isolation of RNA and reverse transcription-polymer chain reaction (RT-PCR). Total RNA was isolated from cell lines and tumor tissues with the Trizol reagent (Invitrogen, Carlsbad, CA, USA) and reversely transcribed using a PrimeScript RT-PCR kit (Takara, Kyoto, Japan) according to the manufacturer's instructions, followed by PCR amplification with specific primers. The following primers were used to amplify most of the coding region of LKB1 (sense, 5’ GGGATGCTTGAGTACGAACCG 3’, and antisense, 5’ AGTACGGCACCACAGTCATGCT 3’) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (sense, 5’-GGAAGGTGAAGGTCGGAGTC-3’and antisense, 5’-AATGAAGGGGTCATTCATGG-3’).

Quantitative real-time PCR was performed using a 7300 Real-time PCR system (Applied Biosystems, Waltham, MA, USA). PCR was carried out in a volume of 20 μl containing 10 μl 2×qPCR Master Mix, 2 μl cDNA, 0.2 μl each primer and 0.4 μl ROX Reference Dye 1. Reaction conditions for amplification of target genes were one cycle of denaturation at 95°C for 5 min, followed by 40 cycles of 5 s degeneration at 95°C, 30 s annealing at 60°C and 40 s prolongation at 72°C. Data were analyzed by the relative standard curve method and normalized to GAPDH expression. Relative RNA expression in the gastric cancer cell lines and patient specimens was calculated using the 2^−ΔΔCt and 2^−ΔCt methods, respectively. All samples were performed in triplicate.

Western blotting. LKB1 protein expression in gastric cancer cell lines was analyzed by Western blotting. Cells were lysed in 100 μl RIPA lysis buffer (50 mmol/l Tris-HCl, pH 7.5, 1% NP-40, 150 mmol/l NaCl, 1 mg/ml aprotinin, 1 mg/ml leupeptin, 1 mmol/l Na₃VO₄, 1 mmol/l NaF) at 4°C for 30 min. Cell debris was removed by centrifugation at 12,000 × g for 20 min at 4°C. Protein concentrations were determined by the Bradford assay (Bio-Red, Hercules, CA, USA). An equal amount of lysate (40 μg) was resolved by sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred to a polyvinylidene difluoride membrane (Millipore, Bedford, MA, USA). The membranes were blocked with 5% nonfat milk at room temperature for 1 h and then incubated for 2 h with primary antibodies to LKB1 and β-actin (Cell Signaling Technology, Boston, MA, USA). The membranes were then incubated for 1 h with an appropriate horseradish peroxidase-linked secondary antibody (Santa Cruz Biotechnology, Dallas, TX, USA). Electro-chemi-luminescence was performed according to the manufacturer's instructions using a ChemiDoc™ Touch Imaging System (Bio-Rad, Hercules, CA, USA). Quantity One software (Bio-Rad) was used to quantify the density of bands.

Immunohistochemical analysis. LKB1 protein expression was measured by immunohistochemical analysis in formalin-fixed, paraffin-embedded tissue sections from 155 gastric cancer and 95 normal gastric epithelial tissue specimens. Two serial sections of 4 μm were cut from each block and placed onto Super Frost Plus glass-slides (Thermo Fisher Scientific Gerhard Menzel, Braunschweig, Germany). Following deparaffinization in xylene, the slides were rehydrated and washed in Tris-buffered saline. The endogenous peroxidase activity was quenched by 10 min incubation in a mixture of 3% hydrogen peroxide solution in 100% methanol (Sigma, St. Louis, MO, USA). Slides were cleared with Tris-buffered saline and placed at room temperature for 1 h. They were then incubated with monoclonal mouse antibody to human LKB1 protein (ab15059; Abcam, Fremont, CA, USA) at 1/100 dilution overnight at 4°C. PBS was used instead of the primary antibody as the negative control. Immuno-staining was performed using the ChemMate EnVision Detection Kit (DAKO, Carpinteria, CA, USA) according to the manufacturer's instruction.

The sections were examined microscopically and interpreted in a blinded fashion by two pathologists. Ten areas were randomly selected and counted at a magnification of ×200. LKB1 staining was evaluated semi-quantitatively on the basis of the percentage of positively-stained cells and classified as follows: 0, no staining or weak staining in <10% of cells; 1+, weak immuno-staining in >10% of cells; 2+, moderate immuno-staining in >10% of cells and 3+, strong immuno-staining in >10% of cells. The staining pattern was either granular or diffuse. Scores of 0 and 1+ indicate a negative tumor, while scores of 2+ and 3+ were regarded as positive.

Statistical analysis. All analyses were performed with SPSS 17.0 software (SPSS Inc., Chicago, IL, USA). Inter-group comparisons of the clinical variables were analyzed using one-way ANOVA analysis for continuous variables and the chi-square test for discrete variables. Survival curves were calculated using the Kaplan–Meier method and compared by the log-rank test. Furthermore, Cox proportional hazard models and logistic regression models were used for multivariate analysis of survival time and the association of LKB1 expression status with clinico-pathological variables, respectively. All p-values were two-sided, with p<0.05 considered to indicate statistical significance.