Expression of Semaphorin 3C in Breast Cancer and its Impact on Adhesion and Invasion of Breast Cancer Cells

Materials and Methods

Identification of breast cancer cohort. Mammary tumours (n=106) along with adjacent normal background tissues (n=28) were collected immediately after surgery with written consent signed by patients. Tissue samples were stored in a freezer (−20°C) until further use. Sectioning of these tissues was performed using a cryostat. These patients were followed-up for 120 months after their surgery. The clinical, pathological features of the cohort are shown in Table I. All protocols were reviewed and approved by the Bro Taf Health Authority local research ethics committee (01/4303).

Extraction of RNA and synthesis of cDNA. At least 25 frozen sections (6 μm/section) from each tissue sample were homogenised in TRI® Reagent (Sigma-Aldrich, Poole, Dorset, UK). Total RNA was subsequently extracted from each sample. The RNA samples were quantified using a UV spectrophotometer. RNA was converted to cDNA using iScriptcDNA synthesis kit (Primer Design Ltd., Southampton, Hampshire, UK).

Detection of SEMA3C using conventional polymerase chain reaction (PCR). Primers were designed using Beacon Designer software (Version 2; Biosoft International, Palo Alto, CA, USA), to amplify regions of human SEMA3C that have no significant overlap with other known sequences. The primers used for SEMA3C amplification were: 5’atttcctatcagggcagaat’3 and 5’actgaacctgaccgtac aaatcctctgcattgagtcag'3. glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal control with the following set of primers, 5’-ctgagtacgtcgtggagtc and 5’-actgaacctgaccgtacagagatg atgacccttttg. The following conditions were used for amplification: 94°C for 5 min, 80 cycles of 94°C for 15 sec, 55°C for 25 sec and 72°C for 30 sec. After 2% agarose gel electrophoresis, amplified products were observed under UV trans-illumination using SYBR® staining.

Quantitative analysis of SEMA3C transcripts using real-time PCR. Expression of SEMA3C in these tissues was also quantified using a quantitative real-time PCR, based on Amplifluor™ technology as previously reported (12). Briefly, reaction conditions comprised of 94°C for 12 min, followed by 50 cycles of 94°C for 15 sec, 55°C for 40 sec and 72°C for 20 sec. GAPDH was used as an internal control. SEMA3C transcript levels were normalised against their corresponding GAPDH levels.

Cell lines and culture conditions. Two breast cancer cell lines (MDA-MB-231 and MCF-7) were purchased from the American Type Culture Collection (Manassas, VA, USA). These cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% foetal calf serum (PAA Laboratories Ltd, Farnborough, Hampshire, UK) and antibiotics (streptomycin and penicillin), at 37°C, with 5% CO₂ and 95% humidity.

Preparation of anti-SEMA3C ribozyme transgenes and SEMA3C knockdown breast cancer cells. Hammerhead ribozymes with corresponding primers were designed based on the secondary structure of SEMA3C mRNA and synthesised using a touchdown PCR procedure following a previously reported method (13, 14). The synthesised ribozymes were then cloned into a mammalian expression plasmid vector (pEF6/V5-His TOPO®; Invitrogen, Ltd., Paisley, UK). MDA-MB-231 cells were transfected with the ribozyme constructs and empty plasmid vector (as a control) using electroporation. After selection for up to 2 weeks with DMEM supplemented with blasticidin (5 μg/ml), expression of SEMA3C was verified using conventional PCR. Cells transfected with the ribozyme and empty plasmid vectors were designated as MDA-MB-231^SEMA3Ckd and MDA-MB-231^pEF (control), respectively. Similarly, MCF-7 cells were transfected, verified and prepared in a similar fashion for subsequent experiments.

In vitro growth assay. The impact of SEMA3C on breast cancer cell proliferation was assessed using a colorimetric-based method (14). On the 1st, 3rd and 5th day of this assay, cells were fixed with 4% formalin solution. Staining was carried out using crystal violet dye. After rinsing with water, cells were treated with 10% acetic acid solution to solubilise the dye. The cell density in each well was determined by measuring absorbance at a wavelength of 540 nm using a Bio-Tek EL x800 multiple plate reader (Bio-Tek Instruments Inc, Winooski, VT, USA).

Adhesion assay. This assay was used to monitor the effect of SEMA3C knockdown on cell attachment to a basement membrane. A 96-well plate was pre-coated with 5 μg Matrigel™ basement membrane (BD Biosciences, Oxford, UK) per well and air dried in a ventilated hood. The plate was rehydrated before seeding 3x10⁴ cells into each well. After a 40-min incubation, non-adherent cells were washed off using phosphate-buffered saline (PBS), adhered cells were then fixed in 4% formalin solution before staining with 0.5% crystal violet. The adhered cells were then counted under an inverted microscope.

Invasion assay. The effect of SEMA3C on invasiveness of breast cancer cells was also assessed by using a transwell invasion assay. Briefly, transwell inserts with 8 μm pores were purchased from Greiner Bio-one (Germany). The inserts were used together with a 24-well tissue culture plate. Each insert was pre-coated with 50 μg Matrigel and air dried. Following a 40-min rehydration, 40x10⁴ cells were loaded into each insert. After culture of 3 days, cells that had invaded through the matrix and migrated across the bottom membrane were fixed, stained and counted.

• Download figure
• Open in new tab
• Download powerpoint

Figure 1.

Expression of semaphorin 3C (SEMA3C) in oestrogen receptor (ER)-positive breast cancer. Data are the mean number of SEMA3C transcripts in tumours according to ER expression. Error bars represent the standard error of the mean.

Statistical analysis. Statistical evaluation was carried out using the Minitab statistical software package (Version 14; Minitab Ltd., Coventry, UK). Non-normally distributed data were assessed using Mann–Whitney test, whereas Student's t-test was used for normally distributed data where appropriate. A p-value of less than 0.05 was defined as statistically significant.