Abstract
Background: A Disintegrin and Metalloprotease Domain 29 (ADAM29) is involved in many important physiological processes. Recent studies have demonstrated that ADAM29 is a susceptibility locus showing traits as a risk factor for breast cancer under genome-wide significance, however, the clinical relevance and cellular function of ADAM29 in breast cancer have not been reported. Materials and Methods: In this study, we assessed the expression levels of ADAM29 in a cohort of human breast cancer specimens. We also used MDA-MB-231 cells with differing ADAM29 expression and assessed the influence of ADAM29 and its mutations on the MDA-MB-231 cell line. Results: Increased transcript expression of ADAM29 was observed in breast cancer tissues compared to normal ones. The expression of ADAM29 and its mutations in different domains significantly influenced proliferation, migration and invasion of breast cancer cells in vitro. Conclusion: ADAM29 may represent a prognostic factor in human breast cancer, as well as a novel molecular candidate to be used as a therapeutic target.
Breast cancer is the most common cancer among females according to 2012 GLOBOCAN statistics, nearly 1.7 million women were diagnosed with breast cancer with 522,000 related deaths (1). If breast cancer is detected at stage IIIB or later, the 5-year survival rate may be significantly reduced than if detected at earlier stages (2). Therefore, it is of high scientific importance to discover an ideal molecular target for diagnosis and treatment of breast cancer.
ADAMs (a disintegrin and metalloprotease) are a family of integral membrane and secreted glycoproteins mediating cell-cell and cell-matrix interaction. They have functional similarity to MMPs in their zinc-binding metalloprotease domains, and are also referred to as the disintegrin, cysteine-rich (MDC) family. They are membrane-anchored glycoproteins containing both protease and adhesion domains that have several biological functions, such as encompassing cell adhesion through their cysteine-rich domains that bind to syndecans and fibronectin (3, 4), cell fusion and signaling (5, 6). Studies have shown that several members of the ADAM family are highly expressed in a variety of human carcinomas, likely contributing to tumor development and/or progression (7-9).
A novel human ADAM gene ADAM29, located in human chromosome 4q34 (10), has been suggested to be involved in cancer development and progression. High ADAM29 expression was predictive of a long treatment-free interval in Binet stage A B-cell chronic lymphocytic leukemia patients (11). ADAM29 up-regulation increased proliferation of gastric carcinoma MKN45 cells, whereas cell-cell aggregation was decreased (12). Recently, several genome-wide association studies have shown that ADAM29 is a susceptibility locus and a risk factor for breast cancer at the genome-wide significance level (13-15). Although ADAM29 has been considered as playing important roles in different kinds of cancers, the precise role and mechanism of ADAM29 in breast cancer remain largely unknown.
Moreover, the presence of distinct somatic mutations in several members of the ADAM family suggests a direct involvement of these genes in cancer genesis. According to existing research, ADAM29 was found under the highest rate of mutation in malignant tumors including melanoma (16), esophageal cancer (17), colorectal cancer (18) and breast cancer (14).
Functional analysis of the frequently mutated ADAM29 in melanoma demonstrated that the mutations affected adhesion of melanoma cells to specific extracellular matrix proteins and in some cases increased their migration ability (16). However, the effects of ADAM29 mutations in breast cancer have not been reported.
In this article, the clinical relevance of ADAM29 expression was analyzed in a cohort of breast cancer samples. The effects of wild-type and point-mutations (P31L, H63Y and L225I) of ADAM29 on cell proliferation, migration and invasion of MDA-MB-231 were first examined in vitro.
Materials and Methods
Human breast specimens. A total of 142 breast samples were obtained from breast cancer patients (31 were normal breast tissue and 111 were breast cancer tissue). These tissues were collected immediately after mastectomy, and snap-frozen in liquid nitrogen, with the approval of the local research ethical committee. Adjacent background normal mammary tissues were obtained from the dissected mammary tissues. The pathologist verified normal and cancer specimens, and it was confirmed that the normal samples were free from tumor deposits. The median follow-up for the cohort was 120 months (June 2004). The relevant information is provided in Table I.
RNA preparation and real-time quantitative polymerase chain reaction (QPCR). Real time quantitative PCR (QPCR) was performed on the Icycler IQ5 system (Bio-Rad, Hammel Hemstead, UK) to quantify the level of ADAM29 transcripts in the breast cancer specimens (shown as copies/μl from internal standard). The QPCR technique utilized the Amplifluor system™ (Intergen Inc., England, UK) and QPCR master mix (BioRad, Camberley, UK). Pairs of primers were designed using Beacon Design software (PREMIER Biosoft, Palo Alto, CA, USA): ADAM29 QPCR primers as follow: sense: 5’-GAATC CCTGG TTTCC CTCAG-3’; antisense: 5’-ACTGAACCTGACCGTACAGTTTCTCCTCACTG TCCAT CTTG-3’. Z-sequence on Q-PCR primers is 5’ACTGAACC TGACCGTACA’3, which is complementary to the universal Z probe (TCS Biologicals Ltd., Oxford, UK). Real-time QPCR conditions were 95°C for 15 min, followed by 60 cycles at 95°C for 20 s, 55°C for 30 s and 72°C for 20 s.
Immunohistochemical staining of breast specimens. The frozen paired tissues were cut into 7-μm sections, and immunohistochemically stained as described previously (19).
ADAM29 monoclonal antibody was from Abnova (Taiwan, China). A peroxidase conjugated goat anti-mouse immunoglobulin IgG was obtained from ZSGB Biotechnology (Beijing, China). The diaminobenzidine (DAB) chromagen (Cell Signal Technology, Danvers, MA, USA) was used for the colouration. Finally, the sections were observed under the microscope (BX43, Olympus, Tokyo, Japan). Staining was independently assessed by the authors.
Patients' characteristics.
Cell line and culture. The breast cancer cell line, MDA-MB-231 was purchased from the Cell Culture Center (cell resource center, shanghai institute for biological sciences, Chinese Academy of Sciences, Shanghai, China), and cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum, penicillin and streptomycin (Gibco BRC, Paisley, Scotland) in an incubator at 37°C, 5% CO2, and 95% humidity.
Preparation of plasmids. ADAM29 cDNA were cloned into GV141 vector by Genechemcompany (Shanghai, China) to obtain the Flag-ADAM29 expression construct. The constructs of ADAM29 mutants P31L, H63Y, L225I were generated based on the wide-type plasmid using phusion PCR for site-directed mutagenesis by Genechem company (Shanghai, China). The shRNA targeted to ADAM29 and the control shRNA plasmids were constructed by Genechem company (Shanghai, China) using vector GV112. The shRNA sequence was 5’-CCGGGCACTCTGACTGATGGTTCTACTCGA GTAGAACCATCAGTCAGAGTGCTTTTTG-3’, and 5’-AATTCA AAAAGCACTCTGACTGATGGTTCTACTCGAGTAGAACCATC AGTCAGAGTGC-3’.
Cell transfection. Sub-confluent cells were transfected with various constructs by using lipofectamine reagent according to manufacturer's instructions (Invitrogen, Camarillo, CA, USA). MDA-MD-231 cells were selected in the culture medium with 1,200 μg/ml G418 or 0.5 μg/ml puromycin respectively for further 21 days to generate stable ADAM29-expressing cells or ADAM29 knockdown cells. ADAM29 expression was verified using western blotting.
Cell proliferation assay. Cell viability was evaluated by a non-radioactive cell counting kit (CCK-8, Dojindo, Kamimashiki-gun, Kumamoto, Japan) assay that was performed according to manufacturer's instructions. Cells were seeded in a 96-well plate at 3×103 cells per well, and after every 24 h, add CCK-8 reagent to each well and the plates were incubated for an additional 1 h at 37°C. Cell viability was measured as the absorbance at 450 nm with an Elx800™ spectrophotometer (BioTek, Winooski, VT, USA).
Wound-healing assay. Migratory property of the breast cancer cells was assessed by wound-healing assay, as described previously (20). Images of the wound were recorded under a phase contrast microscope at different time (0 h, 6 h, 12 h, 24 h). Wound closure/cell migration was evaluated with Image-Pro plus.
Correlation of ADAM29 mRNA expression and clinical parameters.
In vitro Matrigel invasion assay. 2×104 cells in 200 μl of culture medium with 1% FBS were added to the upper chamber of transwell chamber (Corning, ME, USA) containing 8.0 μm pores, while the lower chamber was filled with 600 μl of culture medium with 20% FBS. After incubated for 48 h, the cells were fixed, stained, and quantified as described before (21).
Statistical analysis. The results of in vitro assays were assessed using non-paired (two-sided) Student's t-test, one-way ANOVA test with SPSS 19.0 software. ADAM29 mRNA values obtained in the QPCR study are given as mean transcript copy number per 50 ng of RNA±SD. The relationship between the expression of ADAM29 and tumor grade, TNM staging and survival status were respectively analyzed using Mann–Whitney U-test (Table II). A p-value <0.05 was defined as statistically significant.
Results
Expression of ADAM29 in the clinical breast cohort. ADAM29 was found expressed in the cytoplasm of both normal breast epithelial cells and cancerous cells in the invasive ductal carcinoma (Figure 1). The staining appeared to be weaker from the normal breast cells compared with breast cancer cells (Figure 1). ADAM29 transcript levels were also examined in the breast cohort using quantitative PCR. An increased level of ADAM29 expression was found in breast tumors, compared to normal tissues (Table II). The expression levels of ADAM29 were found to be elevated in the moderately differentiated (grade 2) and poorly differentiated (grade 3) tumors when compared to well differentiated (grade 1) tumors. A trend was also observed that higher levels of ADAM29 transcripts tended to be more frequently observed in the local advanced tumors (TNM II and III) tumour. Further analysis of ADAM29 transcript levels against the clinical aspects demonstrated that increased ADAM29 expression was correlated with poor disease prognosis (included with metastasis, with local recurrence and died of breast cancer) over the 10 year follow-up period in comparison with those who remained disease-free. These results suggested that ADAM29 expression is associated with the poorer-outcome patients of breast cancer, though these differences were not statistically significant.
ADAM29 expression affected malignant phenotypes of MDA-MB-231 cells. ADAM29 protein was strongly present in the ADAM29-overexpressing cells (Figure 2A) and reduced in the ADAM29-knockdown cells (Figure 2B). Compared to control cells, cell proliferation were significantly promoted from the second day, and by up to 54% in cells overexpressing ADAM29 on day 4 (Figure 2C), while cell proliferation was reduced to 68% on day 4 in MDA-MD-231 ADAM29-kd cells (Figure 2D). Cell migration and invasion of ADAM29 overexpression cells were also increased up to 94% and 20% at 24 h and 48 h, respectively (Figure 2E and G). The knockdown of ADAM29 significantly reduced the migratory and invasive nature of breast cancer cells (Figure 2F and H). These results strongly suggested that ADAM29 plays an important role in the regulation of malignant phenotypes of MDA-MB-231 cells by promoting cell proliferation, migration and invasion.
Expression of ADAM29 in normal breast tissue and breast cancer tissue. Different levels of ADAM29 were detected in the cytoplasm of both normal breast cells and cancer cells. Immunohistochemical staining revealed the increased staining of ADAM29 in breast cancer sections compared to normal tissue.
Effects of ADAM29 mutation on cell growth, migration and invasion. ADAM29 was reported to be frequently mutated in melanoma (16). Most mutations were found located in the pro-protein and reprolysin domain of ADAM29 proteins. To further examine if these mutations could regulate the oncogenic function of ADAM29, two missense mutations P31L and H63Y located within proprotein of ADAM29 and mutation L225I within reprolysin of ADAM29 were introduced into MDA-MB-231 cells respectively. As demonstrated by western blotting, these mutants were expressed at similar levels to wild-type ADAM29 (ADAM29-ex) (Figure 3A). We then explored their effects on the malignant phenotypes of cancer cells. As shown in Figure 3B, each of the ADAM29 mutations significantly increased cell proliferation. ADAM29 P31L and H63Y mutations significantly increased the cell proliferation to a similar level that was seen in wild-type ADAM29 overexpression cells. While the growth rate of cells overexpressing ADAM29 L225I was 17.2% more than those expressing wild-type ADAM29 on day 4, which suggested a stronger capability of promoting cell growth of ADAM29 L225I. As well as the effects on cell growth, P31L, H63Yand L225I mutations of ADAM29 increased the capability of cell invasion compared with wild-type ADAM29 (Figure 3C). Furthermore, three of the ADAM29 mutants showed a similar effect with the wild-type protein on cell invasion. In contrast, the various ADAM29 mutants reduced cell migration compared to wild-type ADAM29, though the more migratory rate was observed in the mutation cells than in vehicle control cells (Figure 3D). These results strongly suggested that ADAM29 and its mutant types participated in the regulation of growth, migration and invasion of breast cancer cells.
ADAM29 promotes cell growth, migration and invasion in vitro. A, B: Overexpression and knockdown of ADAM29 at the protein level in breast cancer MDA-MB-231 cells were verified using western blot. C: ADAM29 overexpression promoted MDA-MB-231 cell growth over the experimental time points compared to control plasmid cells. D: Reduced growth rate of cells was seen in ADAM29-knockdown MDA-MB-231 cells. E, G: Significant increase in cell migration and cell invasion were seen in ADAM29-overexpressing cells. F, H: A reduced migration and cell invasion was seen in the MDA-MB-231 ADAM29-knockdown cells. *p<0.05, **p<0.01.
Effects of mutant ADAM29 on cell growth, migration and invasion. A: The wild-type (ADAM29-ex) and mutants of ADAM29 (P31L, H63Y, L225I) were overexpressed in MDA-MB-231 cells. B: ADAM29 wild-type and mutants promoted the growth of MDA-MB-231 cells at the same level. C: Overexpression of ADAM29 mutations increased the invasive capability of MDA-MB-231 cells. D: The ADAM29 mutants reduced cell migration compared to wild-type ADAM29. *p<0.05, **p<0.01.
Discussion
Recently, the ADAM family was reported to have an association with the progression of human breast cancer (22-25). In the current study, we reported that increased transcript expression of ADAM29 was observed in the breast cancer tissue sections compared to normal tissues. The follow-up analysis presented that ADAM29 expression was increased in poorer-outcome patients with breast cancer. The results suggested an oncogenic role of ADAM29 in breast cancer, that was further confirmed by the in vitro function assays. Overexpression of ADAM29 promoted cell proliferation of MDA-MD-231 cells, and knockdown of ADAM29 showed the opposite effect on cell proliferation. It was also observed that knocking down ADAM29 reduced the ability of migration and invasion in breast cancer cell lines. On the contrary, higher expression of ADAM29 sharply promoted migration and invasion compared to control cells. The results of both gain-of-function and loss-of-function studies indicated that ADAM29 acted as an oncogene in breast tumor cells.
A systematic mutational analysis of the ADAMs gene family in human cancers discovered two frequently mutated ADAM genes, ADAM7 and ADAM29. 1,465 mutations in ADAM29 identified from 727 donors were reported by 40 projects (https://dcc.icgc.org/genes/ENSG00000168594). Most mutations located in the pro-protein and reprolysin domains of ADAM29 protein. The expression of the ADAM29 mutants in melanoma substantially increased the melanoma cell adhesion to collagen I and IV compared to cells expressing wild-type ADAM29 (16). However, the effects of ADAM29 mutations in breast cancer have not been reported to date. In order to study the effects of ADAM29 mutations on cell function, three mutants (P31L, H63Y andL225I) were constructed. P31L and H63Y located in the pro-protein domain of ADAM29, while L225I located within the reprolysin domain. Results showed that three mutations of ADAM29 increased the invasive capability of MDA-MB-231 cells that may play a pivotal role in the process of tumor progression and metastasis. In addition, the mutation in the reprolysin domain of ADAM29 enhanced the oncogenic role of wild-type ADAM29 on promoting proliferation of MDA-MD-231 cells. In contrast, the ADAM29 mutants reduced cell migration compared to wild-type ADAM29.
The development of normal breast tissue into breast cancer should undergo the stage of atypical hyperplasia, carcinoma in situ, and invasive cancer, then metastases occur. Tumor cells should firstly obtain a strong ability of proliferation and invasion at the early stage of tumor development and progression. Migration is the ability of cells to move to another place, or movement in the blood and lymph vessel. The three mutants of ADAM29 in our study increased the invasion ability of breast cancer cells, and L225I allow the breast cancer cells to obtain a stronger proliferative ability. These results suggested that ADAM29 mutants could play an important role mainly in the development of breast cancer at the start and early stage.
In conclusion, our data showed that higher levels of ADAM29 were apparent in patients with poorer outcome. The results of both gain-of-function and loss-of-function studies indicated that ADAM29 may act as an oncogene in tumor cells. Mutations in different domain of ADAM29 affected proliferation, migration and invasion of breast cancer. All these findings could provide significant clinical applications, including the use of ADAM29 as a molecular marker in breast cancer diagnosis, as well as an indicator for prognosis. In addition, ADAM29 may present a novel molecular candidate for therapeutic target in breast cancer, that requires further study to better understand the mechanism of action.
Acknowledgements
This work was supported by National Natural Science Foundation of the People's Republic of China (No. 81572704, 81471229) and the Foundation of Beijing Educational Committee (No. KM2013100 25003). The Authors wish also to thank the Beijing Municipal Science & Technology Commission for their support (No. Z15110000 1615039).
- Received January 18, 2016.
- Revision received February 19, 2016.
- Accepted February 22, 2016.
- Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved
