Abstract
Background: Epidermal growth factor (EGF) induces various biological signaling pathways, including proliferation and differentiation and it is the natural ligand of the epidermal growth factor receptor (EGFR) which is a member of tyrosine kinase transmembrane receptor family. EGF and EGFR control important processes in carcinogenesis and several differences in this signaling pathway are very common in certain types of cancers. In present study, we examined EGF A61G gene polymorphism as a marker of risk and progression in gastric cancer. Materials and Methods: A total of 84 patients with gastric cancer and 146 control individuals were enrolled in the current study. EGF A61G gene variation was genotyped by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis. Results: The distribution of EGF A61G genotypes were different between patients with gastric cancer and controls (p=0.039). Serum EGF levels in gastric cancer cases were significantly lower than those in controls (p=0.012). There were no correlations between the serum EGF levels according to EGF A61G genotype and allelic distributions in patients with gastric cancer. Conclusion: Our findings suggested that EGF A61G gene variations and EGF serum levels might be associated with the risk of gastric cancer.
Gastric cancer is a common malignancy and the incidence this type of cancer varies in different regions of the world, between several ethnic groups (1). Gastric carcinogenesis is a multistep process with a complicated etiology, closely related to biological and chemical carcinogens which can lead to DNA damage and mutations involving multiple genetic and epigenetic alterations in oncogenes, tumor-suppressor genes, DNA repair genes, cell-cycle regulators and signaling molecules (1, 2, 3, 4).
The epidermal growth factor (EGF) is the natural ligand of epidermal growth factor receptor (EGFR) (5) and a member of the EGF superfamily, which also includes epiregulin, betacellulin, amphiregulin, transforming growth factor-α and heparin-binding EGF-like growth factor (6). EGF is an important growth factor that promotes biological responses including DNA synthesis, cell proliferation, differentiation and migration in normal cells and has been implicated in stimulating mitogenesis and malignant transformation in epidermal tissue and enhancing tumor growth (7, 8, 9, 10).
The EGF gene has been mapped to chromosome 4q25-27 and consists of 24 exons and 23 introns (11). EGF gene has a single nucleotide polymorphism in the 5’ UTR at position 61 (A61G) which involves the substitution of adenine (A) to guanine (G) (10, 11, 12). Previous research indicated that the EGF A61G single nucleotide polymorphism is related to the risk of some tumors such as melanoma, glioblastoma multiforme and gastric cancer (13, 14, 15).
The present study was designed to define the role of EGF A61G gene polymorphism in gastric cancer development and risk using a case-control design. To further study the potential functional effect of EGF A61G in gastric cancer risk, we measured serum EGF levels in patients with gastric cancer.
Materials and Methods
Study groups. The present study was approved by the Ethical Committee of Istanbul University, The Istanbul Faculty of Medicine Project No.8941]. Eighty-four patients with gastric cancer were included in the present study. All cases were treated at the Istanbul Education and Research Hospital Surgery Clinic and the Kocaeli University, School of Medicine, Department of General Surgery in 2007 and 2009. The mean ages patients with gastric cancer was 56.94±13.78 years. The diagnoses of the patients were determined by endoscopic, radiological and operative findings. The pathological staging was consistent with pathological reports and clinical charts. We collected the blood samples from patients with gastric cancer before any treatment had been started (chemotherapy or radiotherapy). A total of 146 healthy and ethnically matched blood donors with mean age 53.06±9.58 years served as controls. Informed consent was given from all study participants.
Characteristics of cases and controls.
Genotyping. Blood specimens were collected in tubes containing EDTA and DNA samples were extracted from whole blood by a salting-out procedure (16). The EGF A61G polymorphism (rs 4444903) was genotyped by the method previously reported by Shahbazi et al. (13) and determined using polymerase chain reaction-restriction fragment length polymorphism analysis. A 242-bp PCR amplification product of the polymorphic gene was detected by using the primers F-5’TGTCACTAAAGGAAAGGAGGT3’ and R-5’TTCACAGAGTTTAACAGCCC3’. The reaction mix containing 50-100 ng genomic DNA was amplified with 1×PCR buffer, 0.2mM of each dNTP, 3 mM MgCl2, 0.2 mM of each primer and 0.5 U of Taq polymerase (MBI Fermentas, Vilnius, Lithuania) in a 25-ml reaction volume. The PCR reactions were started with an initial denaturation the DNA at 94°C for 5 min, followed by 35 cycles at 94° C for 1 min, 60°C for 1 min and 72°C for 1 min. The final extension step was at 72°C for 5 min. The PCR products were digested with AluI restriction enzyme (MBI Fermentas, Vilnius, Lithuania) overnight at 37°C and then underwent electrophoresis in 3% agarose gel containing ethidium bromide. After the digestion by the restriction enzyme, the AA genotype produced four fragments (15, 34, 91 and 102 bp) and the GG genotype produced three fragments (15, 34 and 193 bp). In the gel, only the 91, 102 and 193 bp fragments were observed.
EGF assay. Blood samples were immediately centrifuged at 10062 ×g for 5 min to separate serum and samples were kept frozen at −20°C until assayed. Serum EGF levels were determined with commercially available sandwich Enzyme-Linked Immuno Sorbent Assay (ELISA) kit (Invitrogen™; Applied Biosystems, Foster City, CA, USA).
Statistical analysis. All statistical analyses were carried out using SPSS software package (revision 11.5; SPSS Inc., Chicago, IL, USA). Data are expressed as means+SD. Numeric values were analyzed by Student's t-test. Differences in characteristics among gastric cancer cases and controls were assessed with the chi-square test, as well as disparities in genotype and allelic frequencies. The Hardy–Weinberg equilibrium was checked with the chi-square test. Odds ratios (ORs) and 95% confidence intervals (95% CI) were calculated to estimate the risk for gastric cancer. Values of p<0.05 were considered as statistically significant. The associations in means between groups were analyzed by Student's t test or ANOVA and Mann Whitney U or Kruskal Wallis tests depending on data distribution.
Genotypes and allelic frequencies for Epidermal Growth Factor (EGF) A61G polymorphism in gastric cancer cases and controls.
Results
Characteristics of patients with gastric cancer and healthy controls are shown in Table I. Table II summarizes the genotypic frequencies and allelic distributions of the EGF A61G polymorphisms in patients with gastric cancer and controls. The frequencies of EGF A61G AA, AG, GG genotypes in cases and controls were 20.2%, 53.6%, 26.2% and 32.9%, 52.1%, 15.1%, respectively. There was a significant difference between the control and patient groups for EGF A61G genotypes. EGF A61G polymorphism GG genotype was statistically higher in patients compared to controls in our study groups (p=0.039). The EGF A61G genotypes were in Hardy-Weinberg equilibrium (p<0.05). The logistic regression analysis indicated that the GG genotype was associated with two-fold increased risk in patients compared to controls even after adjustment for age and gender.
Upon pathological analysis, the T-stage was determined as T1: 3.1%, T2: 25%, T3: 32.8% and T4: 39.1%; lymph node-negative status cases comprised 18.8%, followed by N1: 39.1% and N2: 26.6%, the least number of patients were N3: 15.6%. The incidence of distant metastasis was 34.4%. The distribution of EGF A61G genotypes according to clinical parameters and tumor characteristics of patients with gastric cancer are summarized in Table III. There was no significant association between the EGF A61G genotype and certain clinical parameters (age, gender, smoking, use of alcohol) and pathological parameters among gastric cancer cases. In the current study, we observed a higher prevalence of AG and GG genotypes in patients with stage T3/T4 stage (82.2%) when compared to the patients with T1/T2 stage (73.7%) gastric cancer, but this difference was not statistically significant (p>0.05). We found the mean serum EGF level in gastric cancer patients to be 27.2±4.9 pg/ml and in controls 29.7±3.9 pg/ml. Serum EGF levels in gastric cancer cases were significantly lower than those in controls (p=0.012). We also did not find any statistically significant differences in the serum EGF level by prognostic parameters such as tumor, node stage, or distant metastasis. There was also no significant difference in serum EGF levels among EGF A61G AA, AG, GG genotypes (p=0.090) (Table IV).
Distribution of Epidermal Growth Factor (EGF) A61G genotypes according to clinicopathological features in gastric cancer cases.
Discussion
Growth factors induce complicated cellular signaling processes that activate cell changes (17, 18). These are positive signals in the cell and balanced by negative signals which control both amplitude and duration (18) of the effects. The balance between these signals is important in maintaining cell homeostasis (18). Differentiation, activation and survival of multiple cell types are controlled by several growth factors which are produced by gastric tumor microenvironment (19). EGF promotes various signaling pathways such as Rat sarcoma (RAS), Rapidly accelerated fibrosarcoma (RAF), Mitogen-Activated Protein Kinase (MAPK) or phosphatidylinositol-3-kinase after binding to its receptor EGFR (18, 20, 21, 22, 23). Several researchers suggested that genetic variations in the EGF promoter region may effect gene expression, dysregulate EGF signaling and cause neoplastic transformation (24, 25).
Previous clinical studies found that the functional rs4444903 single nucleotide polymorphism in EGF gene leads to higher EGF levels in persons with the GG EGF genotype and it has been associated with an increased risk of multiple types of human malignancy (13, 26, 27).
According to the literature, the EGF A61G mutation varies significantly in some ethnic groups and allelic frequencies are correlated with genetic backgrounds and geographical regions. To our knowledge, the present study is the first to evaluate the EGF A61G polymorphism in relation to gastric cancer risk in a Turkish population. Our data support the existence of an association between EGF A61G polymorphism and the susceptibility to gastric cancer in the Turkish population. We found that individuals carrying the G allele had increased risk of gastric cancer compared those with the A allele. However, Goto et al. suggested that this polymorphism was not associated with gastric cancer but that the EGF AA genotype had a protective effect (28). Likewise Hamai et al. found the A allele to be significantly less frequent in patients than in controls (15). Individuals with the AA or AG genotype had a notably lower risk of gastric cancer than those with the GG genotype, whereas the same genotypes were associated with malignant progression of cancer, e.g. deeper tumor invasion, increased lymph node metastasis and advanced clinical stage and histological classification in patients with gastric cancer.
In another study, Zhong et al. found a slight decrease in A allelic frequency in patients and associated the EGF G allele with increased risk of hepatocellular carcinoma in a Chinese population (29). Similarly Lin et al. reported that patients with colonic cancer had a significantly higher frequency of EGF GG genotype than did the controls (30). When they stratified their data according to tumor location, tumor size, growth pattern differentiation and tumor-node-metastasis (TNM) stage of colonic cancer, they did not find any statistically significant results. In the present study, we did not find a significant association between EGF A61G genotype and clinical parameters such as age, gender, smoking and alcohol use and pathological parameters such as lymph node metastasis, distant metastasis, angiolymphatic or perineural invasion and differentiation. As a contradictory result, Araújo et al. suggested that individuals carrying the G homozygous genotype had a lower risk for developing breast cancer (31). In another study, Araújo et al. reported that they did not find any difference in the risk of gastric cancer according to genotypic distribution of EGF A61G polymorphism, but they observed that males carrying A alleles had an increased risk for developing gastric cancer as compared to GG homozygous males (12). Kang et al. showed that there is no association between the EGF A61G polymorphism and susceptibility to lung cancer in a Korean population (32). Lanuti et al. reported that patients with EGF GG genotype exhibit a two-fold increased risk of esophageal adenocarcinoma. They also associated the EGF GG genotype with higher EGF levels in tumor-free patients with gastroesophageal reflux disease (27). In another study, Tomaszewski et al. suggested that low plasma EGF levels may increase the risk of endometrium carcinoma (33); in contrast, Pawlikowski et al. reported a decrease in the risk of gastric cancer (34). Wang et al. found significantly lower EGF levels in patients with breast cancer than in their controls (35). Similarly, we found a low serum EGF level in patients with gastric cancer than in controls and this finding was statistically significant.
The Distribution of Epidermal Growth Factor (EGF) A61G genotypes and serum EGF levels in case and control groups.
Although our study has certain limitations, such as the small size of the study group, our findings suggest that EGF A61G gene variations and serum EGF level might be associated with the risk of gastric cancer, although further studies are required to confirm our results in larger groups.
Acknowledgements
The present work was supported by the Research Fund of Istanbul University. Project No. 8941.
- Received February 1, 2015.
- Revision received February 17, 2015.
- Accepted February 20, 2015.
- Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved
References
In this issue
Jump to section
Related Articles
Cited By...
- No citing articles found.