Skip to main content

Main menu

  • Home
  • Current Issue
  • Archive
  • Info for
    • Authors
    • Subscribers
    • Advertisers
    • Editorial Board
  • Other Publications
    • In Vivo
    • Cancer Genomics & Proteomics
    • Cancer Diagnosis & Prognosis
  • More
    • IIAR
    • Conferences
    • 2008 Nobel Laureates
  • About Us
    • General Policy
    • Contact
  • Other Publications
    • Anticancer Research
    • In Vivo
    • Cancer Genomics & Proteomics

User menu

  • Register
  • Subscribe
  • My alerts
  • Log in
  • Log out
  • My Cart

Search

  • Advanced search
Anticancer Research
  • Other Publications
    • Anticancer Research
    • In Vivo
    • Cancer Genomics & Proteomics
  • Register
  • Subscribe
  • My alerts
  • Log in
  • Log out
  • My Cart
Anticancer Research

Advanced Search

  • Home
  • Current Issue
  • Archive
  • Info for
    • Authors
    • Subscribers
    • Advertisers
    • Editorial Board
  • Other Publications
    • In Vivo
    • Cancer Genomics & Proteomics
    • Cancer Diagnosis & Prognosis
  • More
    • IIAR
    • Conferences
    • 2008 Nobel Laureates
  • About Us
    • General Policy
    • Contact
  • Visit us on Facebook
  • Follow us on Linkedin
Research ArticleClinical Studies

Methylation-associated Silencing of microRNA-126 and its Host Gene EGFL7 in Malignant Pleural Mesothelioma

MORTEN ANDERSEN, DAVIDE TRAPANI, JESPER RAVN, JENS BENN SØRENSEN, CLAUS BØGELUND ANDERSEN, MORTEN GRAUSLUND and ERIC SANTONI-RUGIU
Anticancer Research November 2015, 35 (11) 6223-6229;
MORTEN ANDERSEN
1Department of Pathology, Rigshospitalet, Copenhagen University Hospital, Copenhagen, Denmark
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
DAVIDE TRAPANI
1Department of Pathology, Rigshospitalet, Copenhagen University Hospital, Copenhagen, Denmark
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
JESPER RAVN
2Department of Thoracic Surgery, Rigshospitalet, Copenhagen University Hospital, Copenhagen, Denmark
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
JENS BENN SØRENSEN
3Department of Oncology, Rigshospitalet, Copenhagen University Hospital, Copenhagen, Denmark
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
CLAUS BØGELUND ANDERSEN
1Department of Pathology, Rigshospitalet, Copenhagen University Hospital, Copenhagen, Denmark
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
MORTEN GRAUSLUND
1Department of Pathology, Rigshospitalet, Copenhagen University Hospital, Copenhagen, Denmark
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: eric.santoni-rugiu.02@regionh.dk morten.grauslund@regionh.dk
ERIC SANTONI-RUGIU
1Department of Pathology, Rigshospitalet, Copenhagen University Hospital, Copenhagen, Denmark
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: eric.santoni-rugiu.02@regionh.dk morten.grauslund@regionh.dk
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Abstract

Background/Aim: We recently reported that miR-126 is down-regulated in malignant pleural mesothelioma (MPM) and can be combined into a 4-microRNA-classifier that can accurately diagnose MPM with high sensitivity and specificity. Herein we analyzed the epigenetic regulation of miR-126 and its host gene EGF-like domain, multiple 7 (EGFL7). Materials and Methods: Resected formalin-fixed paraffin-embedded MPM tissues from 29 patients, 14 patient-matched non-neoplastic pleura (NNP) specimens, 5 MPM diagnostic biopsies (DB), and 5 samples of pneumothorax-induced benign reactive mesothelial proliferation (PTHX) were analyzed. miR-126 and EGFL7 mRNA were quantified by RT-qPCR. CpG-islands' methylation in the EGFL7 promoter was analyzed using methylation-specific PCR and in the MIR126-containing intron 7 was quantified by pyrosequencing. Results: Relative to NNP, EGFL7 was under-expressed more than 4-fold in MPM (p<0.001). EGFL7 mRNA and miR-126 levels correlated in MPM (p<0.01) and NNP (p<0.001). The EGFL7 promoter region was hypermethylated in 69% of MPM and 80% of DB samples, but not in NNP and PTHX samples. EGFL7 promoter hypermethylation was associated with epithelioid histology (p<0.05) and reduced patient-survival (p<0.05). Conclusion: In MPM, DNA-hypermethylation down-regulates miR-126 and its host gene EGFL7, therefore is a poor prognostic factor, and may represent a future therapeutic target for de-methylating strategies re-establishing EGFL7 and miR-126 expression.

  • Malignant pleural mesothelioma
  • miR-126
  • EGFL7
  • DNA-methylation
  • prognosis
  • biomarker

Malignant pleural mesothelioma (MPM) is a very aggressive, usually asbestos-induced cancer with dismal prognosis, originating from the mesothelial cells lining the pleura (1). Histologically MPM is classified as epithelioid, sarcomatoid or biphasic sub-types and the proportions of each are 50-60%, 10% and 20-30%, respectively (1).

Epidermal growth factor-like protein 7 (EGFL7) is secreted by endothelial cells and contributes to development of the embryonal vascular system. While EGFL7 is not expressed in the majority of mature vessels, highly vascularized tissues such as the lung, kidney and heart maintain high levels of EGFL7 into adulthood (2). In circumstances requiring angiogenesis, such as wound healing or tumorigenesis, EGFL7 is up-regulated and regulates the endothelial cells' sprouting that forms new vessels (3).

The EGFL7 gene is located on chromosome 9q34.3 and contains 11 introns and 3 independent transcriptional initiation sites (S1-3) that are related to the expression of full-length EGFL7 and two major transcript variants. While the full-length EGFL7 transcript is non-coding, transcript variant 1 (accession no. NM_016215) and transcript variant 2 (no. NM_201446) encode the same EGFL7 protein precursor (4).

MicroRNAs (miRNAs) are short (18-24 nucleotides) non-coding RNAs that regulate gene expression by binding to complementary sequences within mRNAs' 3’-untranslated region, thereby repressing translation and reducing the level of targeted transcripts (5). miRNAs are key regulators of fundamental cellular processes such as cell proliferation, apoptosis, differentiation, organ development and metabolism (6). Accordingly, de-regulated miRNAs may contribute to development of several cancer types (7-9). miR-126 (MIR126) is located within intron 7 of its host gene EGFL7 (10). Through targeting genes such as vascular endothelial growth factor A (VEGFA), EGFL7 itself, insulin receptor substrate-1 (IRS1), Kirsten rat sarcoma viral oncogene homolog (KRAS) and phosphoinositide-3-kinase, regulatory subunit 2 (PI3KR2), miR-126 has been linked to vascular integrity and tumor suppression (11-14).

View this table:
  • View inline
  • View popup
  • Download powerpoint
Table I.

Correlation analyses of EGFL7 (transcript variant 1) promoter methylation status and standard clinicopathological parameters in MPM patients (N=29).

Previous investigations have identified CpG-islands in intron 2 and 7 of EGFL7 and have demonstrated that miR-126 is not transcribed from its own promoter but is co-expressed with transcript variant 1 of EGFL7. Furthermore, the transcription initiation site (S2) has been located to the CpG-island in intron 2 of EGFL7 (15). The expression of genes harboring CpG-islands within promoter regions can be silenced by methylation of cytosine residues. In a cancer context, the process of aberrant transcriptional silencing by deregulated DNA-methylation can precede genetic mutations and represents an early event in cancer initiation and progression (16, 17).

We recently reported that miR-126 is down-regulated in MPM and the expression levels of miR-126, -143, -145, and miR-652 can be successfully combined into a 4-miRNA classifier that accurately diagnoses MPM with high sensitivity and specificity and correlates with overall survival (18). Herein, we investigated the methylation-associated regulation of miR-126 host gene EGFL7, in order to elucidate the molecular mechanism(s) of miR-126 down-regulation in MPM. We showed that the expression of miR-126 and EGFL7 is concomitantly down-regulated in MPM through methylation of the S2 CpG-island promoter and that silencing of EGFL7 is associated with a poor clinical outcome.

Materials and Methods

Patients and tissue samples. All patients included in the study were diagnosed and treated at the Rigshospitalet–Copenhagen University Hospital (Copenhagen, Denmark) in the period between 2006-2012. Diagnostic biopsies (DBs) were sampled from 5 MPM patients (4 males, 1 female; median age: 65, age range= 46-68; histotypes: 3 epithelioid MPM (EMM), 2 biphasic MPM (BMM)) prior to any neoadjuvant chemotherapy or cytoreductive surgery. Surgical specimens of MPM were collected from 29 MPM patients (21 males, 8 females, median age: 64, age range: 44-72) with the demographic and clinical features shown in Table I. Surgical treatment was either extrapleural pneumonectomy or pleurectomy/decortication as part of the trimodal protocol, that at our Institution is offered to operable patients (with sufficient cardiopulmonary function and no involvement of N2/N3 lymph nodes) diagnosed with EMM or BMM with <50% sarcomatoid component. Patient-matched histologically verified specimens of non-neoplastic pleura (NNP) were available from 14 of the 29 operated MPM patients. Because of the diffuse growth of MPM, sampling of NNP from the remaining 15 MPM patients was unsuccessful. As part of tri-modal therapy all MPM patients were administered 1-3 series of cisplatin/pemetrexed before surgery. To further verify differential miR-126 and EGFL7 expression profiles in cancerous and non-cancerous tissues, benign pleural specimens of reactive mesothelial proliferations caused by spontaneous pneumothorax (PTHX) were collected from 5 patients (all males; median age: 34 years, age range: 20-37 years) undergoing video-assisted thoracic surgery. All the tissue specimens analyzed in this study were formalin-fixed and paraffin-embedded (FFPE) and characterized by two thoracic pathologists (CBA and ES-R) according to current guidelines for histopathological diagnosis of MPM (1).

Figure 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 1.

Analysis of EGFL7 (transcript variant 1) expression in non-neoplastic and malignant pleural tissues. (A) Correlation of EGFL7 and miR-126 expression in malignant pleural mesothelioma (MPM; n=29) and non-neoplastic pleura (NNP; n=14). Linear regression line (black) with 95% confidence bands (grey) is shown. (B) Scatter plot of EGFL7 expression in diagnostic biopsies (DB), MPM, NNP, and pneumothorax-induced benign reactive mesothelial proliferation (PTHX) samples. Horizontal lines mark the mean expression. Significant differences determined by 1-way analysis of variation and Bonferroni post-tests are marked. (C) Line-series plot of EGFL7 expression in patient-matched samples of MPM and corresponding NNP. Groups were compared using the Student's paired samples t-test. (D) EGFL7 expression in epithelioid malignant mesothelioma (EMM) and bi-phasic malignant mesothelioma (BMM). Groups were compared using the Student's unpaired sample t-test. Horizontal lines mark the mean expression. *Data are presented as log2-transformed ratio according to the 2-ΔCq method (ΔCq=Cq, Target–Cq, Reference). Internal reference genes: snRNA, C/D box 49A (SNORD49A); glyceraldehyde-3-phosphate dehydrogenase (GAPDH). p<0.05 was significant.

Ethics. Approval for the study was obtained from the Scientific Ethical Committees of The Capital Region of Denmark (J.NR. H-3-2011-135) and the national Data Protection Agency of Denmark (J.NR. 2011-41-6825).

Reverse-transcription quantitative PCR (RT-qPCR). Quantification of miR-126 was performed as recently reported (18). For quantification of EGFL7 (transcript variant 1) mRNA (200 ng) was reverse-transcribed using AffinityScript cDNA Synthesis Kit (Agilent Technologies, Santa Clara, CA). RT-qPCR amplification was performed using Brilliant III Ultra-Fast SYBR® Green QPCR Master Mix (Agilent Technologies) using primers and method as described (15) on a Rotor-Gene Q 6000 5plex platform (Qiagen, Hilden, Germany). All RT-qPCR data are presented as log2-transformed ratio according to the 2−ΔCq method (ΔCq=Cq, Target – Cq, Reference).

Detection of DNA-methylation. Genomic DNA was extracted from 4 x 10-μm-thick FFPE tissue-sections utilizing QIAamp DNA Mini Kit (Qiagen). Bisulfite treatment was performed using the EpiTect Bisulfite Kit (Qiagen). Methylation of the CpG-islands in the genomic region flanking the S2 transcriptional start site of EGFL7 was detected using methylation-specific PCR (MSP) as previously described (15) and PCR products were analyzed by high-resolution capillary electrophoresis via a QIAxcel Advanced System (Qiagen). The level of CpG-methylation at MIR126-containing intron 7 of EGFL7 was quantified by pyrosequencing amplifying bisulfite-converted genomic DNA using the PyroMark PCR Kit (Cat. No. 978703, Qiagen) and specific primers for the S2 region (forward: 5’-GGAGTTTTATATTAGTTAAGAAGGTAGAAG-3’ / reverse: 5′-biotin-ACCACCCTAAAAAAAATCAAAACTAAAATC-3’). The PCR amplification was performed on a thermal-cycler with enzyme activation at 95°C for 10 min, followed by 40 cycles of denaturing for 15 sec at 94°C, annealing for 30 sec at 55°C, extension for 30 sec at 72°C and final extension for 10 min at 72°C. Thereafter, single-stranded DNA was isolated by Streptavidin Sepharose High Performance beads (GE Healthcare, Little Chalfont, UK) and pyrosequencing performed using a specific sequencing primer (5’-ATTAGTTAAGAAGGTAGAAGT-3’) and PyroMark Q24 System (Qiagen). The analyzed sequence was: TTTC/TGTTTC/TGGGGTTTGTTTGTATTAGC/TGTAG. Pyrograms were analyzed using system-related PyroMark Q24 Analysis Software (version 2.0).

Figure 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 2.

Representative results of methylation-specific PCR (MSP) analysis by high-resolution capillary electrophoresis of the S2 CpG-island promoter in specimens of MPM, DB, NNP and PTHX. EUCD: EpiTect unmethylated control DNA; EMCD: EpiTect methylated control DNA; M: methylated genomic DNA; U: unmethylated genomic DNA.

Statistical analysis. Contingency tables were analyzed using the Fisher's exact test. Gene expression in two groups of independent or patient-matched tissue-specimens was compared using the Student's two-tailed unpaired or paired samples t-test, respectively. Correlation of continuous variables was determined using linear regression. Gene expression in three groups or more were compared using one-way analysis of variation (ANOVA). p-Values for direct comparisons were adjusted for mass significance using Bonferroni post-tests. Analysis of overall survival times was performed according to the Kaplan-Meier method. Survival curves of dichotomized patients were compared using Mantel-Cox log-rank test. All statistical calculations were executed using OriginPro (version 8.6.0, OriginLab Corp., Northampton, MA) or SAS (version 9.4, SAS Institute Inc., Cary, NC). p<0.05 was considered significant.

Results

First, we tested whether miR-126 and EGFL7 (transcript variant 1) were concomitantly expressed in MPM, as previously described for primary bladder and prostate cancer (15). Linear regression analysis showed that the expression of EGFL7 and miR-126 was significantly correlated in both MPM (n=29, r=0.58, p<0.01) and NNP (n=14, r=0.94, p<0.001) (Figure 1A). To further investigate the de-regulation of EGFL7 and miR-126 expression in malignant vs. non-neoplastic pleural tissue, we determined the level of EGFL7 mRNA in 29 surgical samples of MPM, 14 patient-matched NNP samples from these MPM patients, 5 DBs from still chemotherapy-naïve MPM patients, and 5 samples of benign reactive mesothelial proliferations from pneumothorax patients (PTHX). The mean EGFL7 expression in the DB and MPM samples was 2.03 (95% CI=1.11-2.95) and 3.17 (95% CI=2.89-3.46), respectively and the difference between the means was not significant (p=0.12; Bonferroni test), indicating that the preoperative chemotherapy did not significantly influence EGFL7 expression. Likewise, no significant difference was found between the mean EGFL7 expression of 5.27 (95% CI=4.66-5.88) in the NNP samples and 5.89 (95% CI=4.55-7.22) in the PTHX samples, respectively (p=1; Bonferroni test). Compared to the group of NNP samples, the MPM specimens displayed significant EGFL7 underexpression by a factor of −4.27 (95% CI=−7.88 - −2.32; p<0.001 Bonferroni test) (Figure 1B). This observation was further substantiated by comparing the subset of patient-matched MPM and corresponding NNP samples directly, which showed a similar significant down-regulation of EGFL7 in the MPM samples by a factor of −4.17 (95% CI=−6.56 - −2.65; p<0.001, Student's paired-sample t-test) (Figure 1C). The set of tested MPM samples consisted of 14 EMM and 15 BMM specimens. When we compared these 2 histological sub-types of MPM, the BMM samples displayed significantly higher EGFL7 expression relative to the EMM specimens by a factor of 1.71 (95% CI=1.19 - 2.46; p<0.01, Students unpaired t-test; Figure 1D).

Next, we determined the methylation status of the EGFL7 S2 promoter region in the tissue samples using the MSP technique. We found methylation of CpG-islands in the S2 region in 4 out of 5 DB samples (methylated/unmethylated ratio: 0.80, 95% CI 0.45-1.00) and in 20 out of 29 MPM samples (methylated/unmethylated ratio: 0.69, 95% CI: 0.52-0.86) but not in any of the NNP or PTHX specimens. Representative results of MSP analysis by high-resolution capillary electrophoresis of the S2 CpG-island promoter region are shown in Figure 2. Accordingly, the expression of EGFL7 (transcript variant 1) in the subset of MPM samples harboring methylated S2 region was significantly lower by a factor of −2.36 (95% CI=−3.19 - −1.75; p<0.001, Student's unpaired t-test) than in the MPM samples without methylated S2 region (Figure 3A).

Then we correlated the methylation status of the EGFL7 S2 promoter region with standard clinico-pathological parameters of the MPM samples (Table I). While we did not observe any significant link between sex, age, smoking history or tumor stage, we did find that the EGFL7 S2 region's methylation was significantly associated with the EMM histological subtype (odds ratio: 14.9, 95% CI=11.1-19.9; p<0.05, Fisher's exact test). This was consistent with the above-described reduced EGFL7 expression in EMM vs. BMM samples (Figure 1D).

Figure 3.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 3.

Analysis of EGFL7 promoter region methylation (A) EGFL7 expression in MPM tissue samples dichotomized by methylation status of the EGFL7 promoter region. Groups were compared using the Student's unpaired samples t-test. Horizontal lines mark the mean expression. (B) Kaplan-Meier analysis of overall survival of MPM patients. MPM patients were dichotomized by methylation status of the EGFL7 promoter region. Survival curves were compared using log-rank test. *p<0.05 was significant.

The potential correlation of the MPM patients' overall survival and methylation status of the EGFL7 S2 region was investigated using the Kaplan-Meier method. Overall survival data were available for 28 MPM patients and comprised of 8 events and 20 censored data. Dichotomizing MPM patients according to the EGFL7 S2 region's methylation status showed that the presence of S2-methylation was associated with significant worse survival (p<0.05, log-rank test; Figure 3B).

We used pyrosequencing of bisulfite-converted genomic DNA to explore the potential methylation of the CpG-island in the MIR126-containing intron 7 of EGFL7 in a sub-set of samples consisting of 8 MPM and 5 NNP specimens, and obtained equivalent outcomes. Indeed, quantitative pyrograms detected higher methylation levels (expressed as relative C/T content in percentages) in all 3 methylation-sensitive CpG-sites present in the region spanning the MIR126 locus of the MPM samples as compared to the NNP specimens. Representative pyrograms related to two cases of patient-matched MPM and NNP samples are presented in Figure 4.

Thus, taken together the results indicate that in MPM hypermethylation of the EGFL7 S2 promoter region correlates with parallel down-regulation of EGFL7 transcript variant 1 and miR-126.

Discussion

Recently, increased EGFL7 expression has been reported in certain human epithelial malignancies including hepatocellular, mammary, and gastrointestinal carcinomas (19). In contrast, reduced EGFL7 expression due to DNA-hypermethylation of the promoter region was observed in cancers of the lung, breast, bladder and prostate (15, 20). However, equivalent investigations have not been performed in MPM until now. As reported by others and our group, miR-126 is under-expressed in MPM (18, 21, 22) and this made us hypothesize that the expression of its host gene EGFL7 might be concomitantly de-regulated by DNA-methylation. Our current results demonstrate that miR-126 is expressed along with EGFL7 in MPM and that tumors with higher EGFL7 mRNA expression equivalently have high miR-126 levels as opposed to MPM with reduced EGFL7 expression that display parallel miR-126 down-regulation. This may be somewhat surprising, given that EGFL7 itself has been identified as a target of miR-126 (12) and miRNAs predominantly act to decrease target mRNA (23). However, the biological mechanism of several miRNAs, including miR-126, and their target regulation have been shown to be dependent on the cellular context (12, 20). Since high levels of EGFL7 mRNA and miR-126 are positively correlated, this may indicate that additional miRNAs are involved in regulating EGFL7 expression.

As stated above, increased expression of EGFL7 has previously been associated with certain epithelial cancers (19). In contrast, our results showed that EGFL7 was equally down-regulated in both chemotherapy-naïve biopsies and surgical MPM samples compared to benign NNP and PTHX specimens. This was further substantiated by comparing EGFL7 expression in patient-matched MPM and NNP samples directly. By comparing the expression of EGFL7 in the histological subtypes of MPM, we found that BMMs expressed higher levels of EGFL7 mRNA than EMMs. This is in accordance with our previous report (18) that described an equivalent higher miR-126 expression in BMMs and may reflect the composite nature and differentiation pattern of the biphasic histotype and cell-type-specific differences in miR-126 and EGFL7 expression.

Figure 4.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 4.

Pyrosequencing analysis of the CpG-island in intron 7 of EGFL7 that contains MIR126. Pyrosequencing was performed using bisulfite-converted genomic DNA. The analyzed sequence was: TTTC/TGTTTC/TGGGGTTTGTTTGTATTAGC/TGTAG. The quantitative pyrograms are related to two cases of patient-matched NNP and MPM. Grey boxes: methylation-susceptible CpG dinucleotides, percentages indicate relative C/T content; light grey boxes: internal control sites for complete bisulfite conversion of unmethylated C residues.

We found that DNA-hypermethylation of the CpG-island in EGFL7 intron 2, which harbors the S2 transcriptional initiation site, was associated with decreased levels of EGFL7 mRNA in MPM, in accordance with findings in other cancer types (15, 20). Consistent with the aforementioned results, we found that DNA-hypermethylation of the EGFL7 S2 flanking region was significantly associated with EMM. Furthermore, DNA methylation of the EGFL7 S2 flanking region was a significant prognostic factor associated with poor survival. Interestingly, this is consistent with the previously reported negative prognostic impact of miR-126 down-regulation in MPM (18). In contrast, patients with hypomethylated DNA at the EGFL7 S2 locus were characterized by favorable prognosis and predominantly comprised biphasic tumor histology (7 out of 8 patients). Although based on few patients, this result is somehow surprising, given that BMM generally is associated with poorer patient survival than EMM (1). Nonetheless, the tissue specimens with hypomethylated DNA at the EGFL7 S2 locus are also characterized by increased levels of miR-126, which has tumor-suppressive functions (11-14, 22) and this may in part explain the favorable survival. In addition, miR-126 downregulates the chemokine stromal cell-derived factor 1 isoform α (Sdf-1α) and the related protein C-X-C chemokine receptor type 4 (CXCR4), which can recruit lymphocytes and mesenchymal stem cells and are overexpressed in MPM (20, 24, 25). These changes in the tumor microenvironment due to miR-126 down-regulation and consequent upregulation of Sdf-1α and its cognate receptor CXCR4 have been related to cancer progression by enhancing invasiveness and metastatic potential of neoplastic cells (20, 25). However, further investigations are required to clarify the mechanistic implications and the carcinogenic role of miR-126 and EGFL7 deregulation in MPM. Understanding the epigenetic co-regulation of EGFL7 and miR-126 in MPM may also provide future therapeutic options for this dismal disease based on new DNA-demethylating agents. Finally, considering that miR-126 is one of the miRNAs that has shown very promising diagnostic potential in MPM (18, 21), the concomitant down-regulation of EGFL7 and DNA-methylation of miR-126 and EGFL7 may represent additional tools that could aid in the difficult differential diagnosis between MPM and reactive mesothelial proliferations.

Acknowledgements

The study received financial support by the Danish Cancer Research Foundation, Sawmill Owner Jeppe Juhl & Wife Ovita Juhl Memorial Scholarship, Copenhagen Municipal's 100th Anniversary Foundation, Rigshospitalet – Copenhagen University Hospital Research Grants, Dagmar Marshall's Foundation, and Erasmus Traineeship Program.

Footnotes

  • ↵* These Authors are equal senior authors.

  • Received July 17, 2015.
  • Revision received September 3, 2015.
  • Accepted September 8, 2015.
  • Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved

References

  1. ↵
    1. Travis WD,
    2. Brambilla E,
    3. Burke AP,
    4. Marx A,
    5. Nicholson AG
    : WHO classification of tumours of the lung, pleura, thymus and heart. Forth edition. Lyon, IARC Press, 2015.
  2. ↵
    1. Parker LH,
    2. Schmidt M,
    3. Jin S-W,
    4. Gray AM,
    5. Beis D,
    6. Pham T,
    7. Frantz G,
    8. Palmieri S,
    9. Hillan K,
    10. Stainier DYR,
    11. De Sauvage FJ,
    12. Ye W
    : The endothelial-cell-derived secreted factor Egfl7 regulates vascular tube formation. Nature 428: 754-758, 2004.
    OpenUrlCrossRefPubMed
  3. ↵
    1. Schmidt M,
    2. Paes K,
    3. De Mazière A,
    4. Smyczek T,
    5. Yang S,
    6. Gray A,
    7. French D,
    8. Kasman I,
    9. Klumperman J,
    10. Rice DS,
    11. Ye W
    : EGFL7 regulates the collective migration of endothelial cells by restricting their spatial distribution. Dev Camb Engl 134: 2913-2923, 2007.
    OpenUrl
  4. ↵
    1. Soncin F,
    2. Mattot V,
    3. Lionneton F,
    4. Spruyt N,
    5. Lepretre F,
    6. Begue A,
    7. Stehelin D
    : VE-statin, an endothelial repressor of smooth muscle cell migration. EMBO J 22: 5700-5711, 2003.
    OpenUrlAbstract/FREE Full Text
  5. ↵
    1. Bartel DP
    : MicroRNAs: target recognition and regulatory functions. Cell 136: 215-233, 2009.
    OpenUrlCrossRefPubMed
  6. ↵
    1. Sayed D,
    2. Abdellatif M
    : MicroRNAs in development and disease. Physiol Rev 91: 827-887, 2011.
    OpenUrlAbstract/FREE Full Text
  7. ↵
    1. Hayashita Y,
    2. Osada H,
    3. Tatematsu Y,
    4. Yamada H,
    5. Yanagisawa K,
    6. Tomida S,
    7. Yatabe Y,
    8. Kawahara K,
    9. Sekido Y,
    10. Takahashi T
    : A polycistronic microRNA cluster, miR-17-92, is overexpressed in human lung cancers and enhances cell proliferation. Cancer Res 65: 9628-9632, 2005.
    OpenUrlAbstract/FREE Full Text
    1. Johnson SM,
    2. Grosshans H,
    3. Shingara J,
    4. Byrom M,
    5. Jarvis R,
    6. Cheng A,
    7. Labourier E,
    8. Reinert KL,
    9. Brown D,
    10. Slack FJ
    : RAS is regulated by the let-7 microRNA family. Cell 120: 635-647, 2005.
    OpenUrlCrossRefPubMed
  8. ↵
    1. Liu C,
    2. Kelnar K,
    3. Liu B,
    4. Chen X,
    5. Calhoun-Davis T,
    6. Li H,
    7. Patrawala L,
    8. Yan H,
    9. Jeter C,
    10. Honorio S,
    11. Wiggins JF,
    12. Bader AG,
    13. Fagin R,
    14. Brown D,
    15. Tang DG
    : The microRNA miR-34a inhibits prostate cancer stem cells and metastasis by directly repressing CD44. Nat Med 17: 211-215, 2011.
    OpenUrlCrossRefPubMed
  9. ↵
    1. Musiyenko A,
    2. Bitko V,
    3. Barik S
    : Ectopic expression of miR-126*, an intronic product of the vascular endothelial EGF-like 7 gene, regulates prostein translation and invasiveness of prostate cancer LNCaP cells. J Mol Med Berl Ger 86: 313-322, 2008.
    OpenUrlCrossRef
  10. ↵
    1. Zhang J,
    2. Du Y,
    3. Lin Y,
    4. Chen Y,
    5. Yang L,
    6. Wang H,
    7. Ma D
    : The cell growth suppressor, miR-126, targets IRS-1. Biochem Biophys Res Commun 377: 136-140, 2008.
    OpenUrlCrossRefPubMed
  11. ↵
    1. Sun Y,
    2. Bai Y,
    3. Zhang F,
    4. Wang Y,
    5. Guo Y,
    6. Guo L
    : miR-126 inhibits non-small cell lung cancer cells proliferation by targeting EGFL7. Biochem Biophys Res Commun 391: 1483-1489, 2010.
    OpenUrlCrossRefPubMed
    1. Zhu N,
    2. Zhang D,
    3. Xie H,
    4. Zhou Z,
    5. Chen H,
    6. Hu T,
    7. Bai Y,
    8. Shen Y,
    9. Yuan W,
    10. Jing Q,
    11. Qin Y
    : Endothelial-specific intron-derived miR-126 is down-regulated in human breast cancer and targets both VEGFA and PIK3R2. Mol Cell Biochem 351: 157-164, 2011.
    OpenUrlCrossRefPubMed
  12. ↵
    1. Jiao LR,
    2. Frampton AE,
    3. Jacob J,
    4. Pellegrino L,
    5. Krell J,
    6. Giamas G,
    7. Tsim N,
    8. Vlavianos P,
    9. Cohen P,
    10. Ahmad R,
    11. Keller A,
    12. Habib NA,
    13. Stebbing J,
    14. Castellano L
    : MicroRNAs targeting oncogenes are down-regulated in pancreatic malignant transformation from benign tumors. PloS One 7: e32068, 2012.
    OpenUrlCrossRefPubMed
  13. ↵
    1. Saito Y,
    2. Friedman JM,
    3. Chihara Y,
    4. Egger G,
    5. Chuang JC,
    6. Liang G
    : Epigenetic therapy upregulates the tumor suppressor microRNA-126 and its host gene EGFL7 in human cancer cells. Biochem Biophys Res Commun 379: 726-731, 2009.
    OpenUrlCrossRefPubMed
  14. ↵
    1. Feinberg AP,
    2. Ohlsson R,
    3. Henikoff S
    : The epigenetic progenitor origin of human cancer. Nat Rev Genet 7: 21-33, 2006.
    OpenUrlCrossRefPubMed
  15. ↵
    1. Arai E,
    2. Kanai Y
    : DNA methylation profiles in precancerous tissue and cancers: carcinogenetic risk estimation and prognostication based on DNA methylation status. Epigenomics 2: 467-481, 2010.
    OpenUrlCrossRefPubMed
  16. ↵
    1. Andersen M,
    2. Grauslund M,
    3. Ravn J,
    4. Sørensen JB,
    5. Andersen CB,
    6. Santoni-Rugiu E
    : Diagnostic Potential of miR-126, miR-143, miR-145, and miR-652 in Malignant Pleural Mesothelioma. J Mol Diagn 16: 418-430, 2014.
    OpenUrlPubMed
  17. ↵
    1. Fan C,
    2. Yang L-Y,
    3. Wu F,
    4. Tao Y-M,
    5. Liu L-S,
    6. Zhang J-F,
    7. He Y-N,
    8. Tang L-L,
    9. Chen G-D,
    10. Guo L
    : The expression of Egfl7 in human normal tissues and epithelial tumors. Int J Biol Markers 28: 71-83, 2013.
    OpenUrlPubMed
  18. ↵
    1. Zhang Y,
    2. Yang P,
    3. Sun T,
    4. Li D,
    5. Xu X,
    6. Rui Y,
    7. Li C,
    8. Chong M,
    9. Ibrahim T,
    10. Mercatali L,
    11. Amadori D,
    12. Lu X,
    13. Xie D,
    14. Li Q-J,
    15. Wang X-F
    : miR-126 and miR-126* repress recruitment of mesenchymal stem cells and inflammatory monocytes to inhibit breast cancer metastasis. Nat Cell Biol 15: 284-294, 2013.
    OpenUrlCrossRefPubMed
  19. ↵
    1. Santarelli L,
    2. Strafella E,
    3. Staffolani S,
    4. Amati M,
    5. Emanuelli M,
    6. Sartini D,
    7. Pozzi V,
    8. Carbonari D,
    9. Bracci M,
    10. Pignotti E,
    11. Mazzanti P,
    12. Sabbatini A,
    13. Ranaldi R,
    14. Gasparini S,
    15. Neuzil J,
    16. Tomasetti M
    : Association of MiR-126 with soluble mesothelin-related peptides, a marker for malignant mesothelioma. PloS One 6: e18232, 2011.
    OpenUrlCrossRefPubMed
  20. ↵
    1. Tomasetti M,
    2. Nocchi L,
    3. Staffolani S,
    4. Manzella N,
    5. Amati M,
    6. Goodwin J,
    7. Kluckova K,
    8. Nguyen M,
    9. Strafella E,
    10. Bajzikova M,
    11. Peterka M,
    12. Lettlova S,
    13. Truksa J,
    14. Lee W,
    15. Dong L-F,
    16. Santarelli L,
    17. Neuzil J
    : MicroRNA-126 suppresses mesothelioma malignancy by targeting IRS1 and interfering with the mitochondrial function. Antioxid Redox Signal 21: 2109-2125, 2014.
    OpenUrlCrossRefPubMed
  21. ↵
    1. Guo H,
    2. Ingolia NT,
    3. Weissman JS,
    4. Bartel DP
    : Mammalian microRNAs predominantly act to decrease target mRNA levels. Nature 466: 835-840, 2010.
    OpenUrlCrossRefPubMed
  22. ↵
    1. Li T,
    2. Li H,
    3. Wang Y,
    4. Harvard C,
    5. Tan J-L,
    6. Au A,
    7. Xu Z,
    8. Jablons DM,
    9. You L
    : The expression of CXCR4, CXCL12 and CXCR7 in malignant pleural mesothelioma. J Pathol 223: 519-530, 2011.
    OpenUrlCrossRefPubMed
  23. ↵
    1. Li Z,
    2. Li N,
    3. Wu M,
    4. Li X,
    5. Luo Z,
    6. Wang X
    : Expression of miR-126 suppresses migration and invasion of colon cancer cells by targeting CXCR4. Mol Cell Biochem 381: 233-242, 2013.
    OpenUrlPubMed
PreviousNext
Back to top

In this issue

Anticancer Research: 35 (11)
Anticancer Research
Vol. 35, Issue 11
November 2015
  • Table of Contents
  • Table of Contents (PDF)
  • Index by author
  • Back Matter (PDF)
  • Ed Board (PDF)
  • Front Matter (PDF)
Print
Download PDF
Article Alerts
Sign In to Email Alerts with your Email Address
Email Article

Thank you for your interest in spreading the word on Anticancer Research.

NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.

Enter multiple addresses on separate lines or separate them with commas.
Methylation-associated Silencing of microRNA-126 and its Host Gene EGFL7 in Malignant Pleural Mesothelioma
(Your Name) has sent you a message from Anticancer Research
(Your Name) thought you would like to see the Anticancer Research web site.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
5 + 5 =
Solve this simple math problem and enter the result. E.g. for 1+3, enter 4.
Citation Tools
Methylation-associated Silencing of microRNA-126 and its Host Gene EGFL7 in Malignant Pleural Mesothelioma
MORTEN ANDERSEN, DAVIDE TRAPANI, JESPER RAVN, JENS BENN SØRENSEN, CLAUS BØGELUND ANDERSEN, MORTEN GRAUSLUND, ERIC SANTONI-RUGIU
Anticancer Research Nov 2015, 35 (11) 6223-6229;

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Reprints and Permissions
Share
Methylation-associated Silencing of microRNA-126 and its Host Gene EGFL7 in Malignant Pleural Mesothelioma
MORTEN ANDERSEN, DAVIDE TRAPANI, JESPER RAVN, JENS BENN SØRENSEN, CLAUS BØGELUND ANDERSEN, MORTEN GRAUSLUND, ERIC SANTONI-RUGIU
Anticancer Research Nov 2015, 35 (11) 6223-6229;
del.icio.us logo Digg logo Reddit logo Twitter logo Facebook logo Google logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • Materials and Methods
    • Results
    • Discussion
    • Acknowledgements
    • Footnotes
    • References
  • Figures & Data
  • Info & Metrics
  • PDF

Related Articles

  • No related articles found.
  • PubMed
  • Google Scholar

Cited By...

  • ADAR2 Regulates Malignant Behaviour of Mesothelioma Cells Independent of RNA-editing Activity
  • Aberrant Methylation of Tumor Suppressive miRNAs in Bile from Patients With Pancreaticobiliary Diseases
  • Four-miRNA Signature to Identify Asbestos-Related Lung Malignancies
  • Epigenetic silencing of LPP/miR-28 in multiple myeloma
  • Google Scholar

More in this TOC Section

  • Effect of Postoperative Muscle Loss After Resection of Non-small Cell Lung Cancer on Surgical Outcomes
  • The Prognostic Relevance of Preoperative CEA and CA19-9 for Ampulla of Vater Carcinoma
  • Difference in the Overall Survival Between Malignant Central Airway Obstruction Patients Treated by Transbronchial Microwave Ablation and Stent Placement: A Single-institution Retrospective Study
Show more Clinical Studies

Similar Articles

Keywords

  • Malignant pleural mesothelioma
  • miR-126
  • EGFL7
  • DNA-methylation
  • prognosis
  • biomarker
Anticancer Research

© 2022 Anticancer Research

Powered by HighWire