Skip to main content

Main menu

  • Home
  • Current Issue
  • Archive
  • Info for
    • Authors
    • Editorial Policies
    • Subscribers
    • Advertisers
    • Editorial Board
    • Special Issues
  • Journal Metrics
  • Other Publications
    • In Vivo
    • Cancer Genomics & Proteomics
    • Cancer Diagnosis & Prognosis
  • More
    • IIAR
    • Conferences
    • 2008 Nobel Laureates
  • About Us
    • General Policy
    • Contact
  • Other Publications
    • Anticancer Research
    • In Vivo
    • Cancer Genomics & Proteomics

User menu

  • Register
  • Subscribe
  • My alerts
  • Log in
  • My Cart

Search

  • Advanced search
Anticancer Research
  • Other Publications
    • Anticancer Research
    • In Vivo
    • Cancer Genomics & Proteomics
  • Register
  • Subscribe
  • My alerts
  • Log in
  • My Cart
Anticancer Research

Advanced Search

  • Home
  • Current Issue
  • Archive
  • Info for
    • Authors
    • Editorial Policies
    • Subscribers
    • Advertisers
    • Editorial Board
    • Special Issues
  • Journal Metrics
  • Other Publications
    • In Vivo
    • Cancer Genomics & Proteomics
    • Cancer Diagnosis & Prognosis
  • More
    • IIAR
    • Conferences
    • 2008 Nobel Laureates
  • About Us
    • General Policy
    • Contact
  • Visit us on Facebook
  • Follow us on Linkedin
Research ArticleExperimental Studies

Spontaneous In Vitro Senescence of Glioma Cells Confirmed by an Antibody Against IDH1R132H

EWELINA STOCZYNSKA-FIDELUS, WALDEMAR OCH, PIOTR RIESKE, MICHAL BIENKOWSKI, MATEUSZ BANASZCZYK, MARTA WINIECKA-KLIMEK, JOLANTA ZIEBA, KAROLINA JANIK, KAMILA ROSIAK, CEZARY TREDA, ROBERT STAWSKI, ANNA RADOMIAK-ZALUSKA and SYLWESTER PIASKOWSKI
Anticancer Research June 2014, 34 (6) 2859-2867;
EWELINA STOCZYNSKA-FIDELUS
1Department of Tumor Biology, Medical University of Lodz, Lodz, Poland
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: ewelina.stoczynska-fidelus{at}umed.lodz.pl
WALDEMAR OCH
2Clinical Department of Neurosurgery, The Voivodal Specialistic Hospital in Olsztyn, Olsztyn, Poland
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
PIOTR RIESKE
1Department of Tumor Biology, Medical University of Lodz, Lodz, Poland
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
MICHAL BIENKOWSKI
3Department of Molecular Pathology and Neuropathology, Chair of Oncology, Medical University of Lodz, Lodz, Poland
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
MATEUSZ BANASZCZYK
1Department of Tumor Biology, Medical University of Lodz, Lodz, Poland
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
MARTA WINIECKA-KLIMEK
1Department of Tumor Biology, Medical University of Lodz, Lodz, Poland
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
JOLANTA ZIEBA
1Department of Tumor Biology, Medical University of Lodz, Lodz, Poland
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
KAROLINA JANIK
1Department of Tumor Biology, Medical University of Lodz, Lodz, Poland
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
KAMILA ROSIAK
1Department of Tumor Biology, Medical University of Lodz, Lodz, Poland
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
CEZARY TREDA
1Department of Tumor Biology, Medical University of Lodz, Lodz, Poland
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
ROBERT STAWSKI
5Department of Clinical Physiology, Medical University of Lodz, Lodz, Poland
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
ANNA RADOMIAK-ZALUSKA
4Neurological Surgery, The Maria Sklodowska-Curie Regional Specialist Hospital in Zgierz, Zgierz, Poland
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
SYLWESTER PIASKOWSKI
1Department of Tumor Biology, Medical University of Lodz, Lodz, Poland
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Abstract

Background: We have recently suggested that glioblastoma cells become spontaneously senescent in cell culture conditions. The antibody specific against IDH1R132H offers the perfect opportunity to verify this hypothesis. Materials and Methods: We analyzed the features of senescence in 8 glioma cell cultures showing the IDH1R132H mutation based on combination of immunocytochemistry, enzymo-cytochemistry, BrdU incorporation assay and real-time microscopic observation. Results: We report that glioma cells showing the IDH1R132H mutation become rapidly and spontaneously senescent in vitro. Senescence was observed in both classical and novel serum-free cell culture conditions. Importantly, the senescent IDH1R132H-positive cells showed the expression of stemness marker (SOX2). Conclusion: In vitro senescence appeared to be the main reason of the difficulties in any kind culturing of glioma cells. 3D cell cultures prolonged the survival and in vitro proliferation of neoplastic IDH1R132H-positive cells, however, did not enhance the stabilization efficiency. Senescence of glioma cells is spontaneously triggered in vitro, which offers the opportunity of potential new therapeutic strategies based on this phenomenon.

  • IDH1 gene
  • glioma
  • glioblastoma
  • astrocytoma
  • senescence
  • 3D cell culture

Senescence is currently under detailed investigation from the perspective of tumor biology. The role of this process is enigmatic; from one perspective, an irreversible inhibition of proliferation may potentially be anti-tumorigenic; on the other hand, some data suggest a proinvasive role of senescent cells (1-4). We have recently reported that glioblastoma cells become easily (spontaneously in cell culture conditions) senescent in vitro (5). These results inspired the question of senescence in cultured IDH1-mutant glioma cells. We based our analyses of senescence in tumor cells on the combination of immunocytochemistry, enzymocytochemistry, BrdU incorporation assay and real-time microscopy. The cells were recognized as neoplastic based on TP53 nuclear accumulation, EGFR overexpression and MAP2/GFAP coexpression. Senescent neoplastic cells showed, apart from the listed markers, the features of senescence such as SA-β-Gal activity and morphological changes. Additionally, supportive data may be extracted from nucleic acid analysis, which, however, were not performed at the single-cell level (5). Such an approach leaves the limited spectrum for uncertainty aside. Moreover, IDH1R132H-specific antibody offers the uncommon possibility to reliably differentiate neoplastic cells and, therefore, is the perfect tool to test the analyzed hypothesis. Additionally, in the present study we performed a comparison of 2D and 3D cultures for the purpose of culturing of IDH1R132H-positive cells isolated from glial tumors.

Materials and Methods

Tumor samples. The analyzed group consisted of 8 consecutive glioma specimens with IDH1 mutation (R132H) obtained from patients treated at the Department of Neurological Surgery, The Maria Sklodowska-Curie Regional Specialist Hospital in Zgierz and at the Clinical Department of Neurosurgery, The Voivodal Specialistic Hospital in Olsztyn. All samples were collected using the protocol approved by the Bioethical Committee of the Medical University of Lodz (Approval No RNN/9/10/KE). Written informed consent was obtained from every patient and their data were processed and stored according to the principles expressed in the Declaration of Helsinki. The patients were diagnosed according to the World Health Organization criteria for brain tumor classification; the diagnosis was glioblastoma (3 cases), anaplastic astrocytoma (1 case), diffuse astrocytoma (3 cases) and anaplastic oligodendro-glioma (1 case).

Irrespective of the cell culture type, the isolation of cells from fresh specimens started within 3 h after the neurosurgical operation. Neurosurgical specimens were shipped in 1x Hank's Balanced Salt Solution (PAA, The Cell Culture Company, Austria).

Cell cultures

Classical monolayer conditions. Fresh tissue samples were washed twice with 1× Hank's BSS and centrifuged for 90 s at 80 × g each time. Then, the sample was transferred to a 10 cm dish, where it was cut into <1 mm3 fragments, washed with 1× Hanks' BSS. Tumor cells were dispersed with collagenase type IV (200 U/mL, 37°C for 6 h; Sigma-Aldrich, USA). The cells were then cultured in αMEM medium (PAA) containing NEAA and supplemented with 10% FBS (Gibco). The total time of isolation and establishment of cell cultures was about seven hours. Depending on the rate of proliferation, the cells were passaged with Trypsin-EDTA (0.05% trypsin; Gibco) to a new culture dish every 7-14 days.

Monolayer conditions in serum-free medium. Fresh tissue samples were washed twice with 1× Hank's BSS and centrifuged for 90 sec at 80 × g. Then, the sample was transferred to a 10-cm dish, where it was cut into <1 mm3 fragments and washed with 1× Hanks' BSS. Tumor cells were dispersed with collagenase type IV (200 U/mL, 37°C for 6 h). The total time of isolation and establishment of cell cultures was approximately 7 h. The cells were cultured in Neurobasal Medium supplemented with N2 and B27 (0.5× each; Invitrogen), human recombinant bFGF (50 ng/mL; Invitrogen), EGF (50 ng/mL; Invitrogen) and NEAA (1×; Gibco). For monolayer cultures, the plates were pre-coated with a poly-L-lysine/laminin mixture (Invitrogen) as previously reported (6). Monolayer cells were passaged with accutase (Invitrogen) (7). The cells under these conditions were passaged less often (every 3-4 weeks) due to their lower proliferation rate.

3D conditions in serum-free medium. Spheroid cell cultures were performed as neurospheres and as adherent spheres (8-10). Fresh tissue samples were washed twice with 1× Hank's BSS) and centrifuged for 90 s at 80 × g each time. Then, the sample was transferred to a 10 cm dish, where it was cut into <1 mm3 fragments, washed with 1× Hanks' BSS, digested with collagenase type IV/dispase (200 u/mL; Sigma-Aldrich) for 30 min at 37°C and then filtered using a 70-μm cell strainer (BD Biosciences, USA). Filtered cells were washed twice with 1× Hank's BSS and centrifuged 90 s at 80 × g each time and then seeded into 6-well plates at 2,500-5,000 cells/cm3. Having prepared the medium and reagents before tissue samples processing, the total time of isolation and establishment of spheroid cell cultures was about 1 h.

3-D cultures could not be constructed from astrocytomas as easily as from glioblastomas. Astrocytoma cells did not proliferate efficiently enough to develop spheroids and, therefore, they were cultured as explants, which were then propagated as spheroids.

The culture consisted of Neurobasal Medium with B27 supplement (20 μl/mL; Invitrogen), Glutamax (10 μl/mL; Invitrogen), fibroblast growth factor-2 (20 ng/mL; Invitrogen), NEAA and heparin (2 μg/mL; StemCell Technologies). Growth factors and heparin were renewed twice a week. For the adherent sphere conditions Matrigel covered plates were used and medium was not supplemented with heparin. The spheres were split by mechanical dissociation and transferred to a new dish when they reached the size of 200-500 μm. Cells were cultured at 37°C in 5% CO2, 95% humidity and without O2 control.

IDH1R132H subcloning and transient transfection. RNA from human mammary gland MCF7 cell line was isolated by AllPrep DNA/RNA Mini Kit (Qiagen, Hilden, Germany) and reverse-transcribed by QuantiTect Rev. Transcription Kit (Qiagen). Q5® Hot Start High-Fidelity DNA Polymerase (NEB, Massachusetts, USA) was used to amplify IDH1 gene with Gateway® specific primers: GGGGACAAGTTTGTACAAAAAAGCAGCGTATGTCCAAAAAAATCAGTGGCG (forward) and GGGGACCACTTTGTACAAGAAAGCTGGGTTAAAGTTTGGCCTGAGCT AGT (reverse), and Gateway® BP Clonase® II Enzyme mix (Life Technologies, Carlsbad, USA) was used to introduce IDH1 to pENTR/zeo vector. The sequence was confirmed with Applied Biosystems 3130 Genetic Analyzer. R132H mutation in IDH1 was inserted by PCR (Q5® Hot Start High-Fidelity DNA Polymerase) with IDH1 specific primers: ATCATAGGTCATCATGCTTATG (forward) and GATAGGTTTTA CCCATCCAC (reverse). The resulting linear plasmid was ligated by T4 DNA Ligase (NEB) and One Shot® OmniMAX™ 2 T1R Chemically Competent E. coli (Life Technologies) were transformed with 3 μl of ligation mix. The plasmid was isolated with NucleoSpin Plasmid (Macherey-Nagel GmbH&Co. KG, Duren, Germany) and sequenced, then Gateway® LR Clonase® II Enzyme mix (Life Technologies) was used to move the IDH1 cassette to pLV/puro-DEST vector. Finally, AD293 cells were transfected with pLV/puro-IDH1R132H using Lipofectamine® LTX (Life Technologies) (Figure 1A-B).

Western blotting. Total cellular protein was isolated from cell cultures using RIPA Lysis and Extraction Buffer supplemented with Halt Protease Inhibitor Cocktail (Thermo Scientific, USA), suspended in 4× Laemmli Sample Buffer (Bio-Rad Laboratories, USA) with β-mercaptoethanol (Sigma, USA) and boiled (95°C, 5 min). After the separation in 10% SDS-polyacrylamide gel (Rotiphorese Ready-to-Use Gel Solutions; Carl Roth GmbH + Co. KG, Germany) the protein was transferred onto PVDF membrane (Bio-Rad Laboratories, USA) and 5% Skim Milk Powder (Sigma, USA) diluted with TBS-T buffer was used to block nonspecific binding sites (1h, room temperature). PVDF membrane was incubated with the mouse antibody against IDH1R132H (1:1000, overnight, 4°C; Dianova, USA) and subsequently with the goat anti-mouse IgG-HRP antibody (1:5,000; Santa Cruz Biotechnology, USA). After washing with TBS-T buffer (4×10 min), Opti-4CN Substrate Kit (Bio-Rad Laboratories, USA) was used for HRP visualization (Figure 1C).

Immunocytochemistry. For immunocytochemical analyses cell cultures were fixed for 10 min in 4% paraformaldehyde in PBS and permeabilized with 0.1% Triton X-100 for 10 min at room temperature. Non-specific binding sites were blocked by incubation with 2% donkey serum (Sigma) in PBS for 1 h. For double or triple immunolabeling, the fixed cells were subsequently incubated with the following antibodies: (1:50) mouse antibody against IDH1R132H (DIA-H09; Dianova), (1:200) rabbit antibody against TP53 (sc-6243; Santa Cruz Biotechnology), (1:50) goat antibody against GFAP (sc-6171, Santa Cruz Biotechnology) and (1:1000) mouse antibody against αSMA (MAB1420, RD Systems), (1:500) rabbit antibody against SOX2 (AB-5603; Millipore), (1:50) rabbit antibody against Nestin (19483-1-AP; Proteintech Europe) for 1 h at room temperature. Double or triple labeling was visualized by simultaneous incubation with a combination of species-specific fluorochrome-conjugated secondary antibodies: (1:500) donkey anti-rabbit AlexaFluor®488; (1:500) donkey anti-mouse Alexa-Fluor®594 and (1:500) donkey anti-goat Alexa-Fluor® 350 (Molecular Probes, Invitrogen) for 1 h at room temperature. The control samples were incubated with the secondary antibodies-alone or with the matched isotype controls instead of the primary antibody and were otherwise processed identically. The slides were mounted with ProLong® Gold Antifade Reagent or ProLong® Gold Antifade Reagent with DAPI (Molecular Probes), coverslipped and examined using a Nikon fluorescence microscope.

Figure 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 1.

Verification of the specificity of the antibody against IDH1R132H; exemplary western blot and sequencing results. Positive (A) and negative (B) control for IDH1R132H antibody after transient transfection of AD293 cells with pLV/puro-IDH1R132H plasmid and empty pLV/puro-DEST plasmid, respectively. (C) Exemplary western blot result with IDH1R132H specific antibody: line 1 – ColorPlus™ Prestained Protein Ladder, Broad Range (10-230 kDa) (#P7711S, NEB); line 2 and 3 – negative controls; line 4 – sample with IDH1R132H mutation (46.5 kDa). (D) Exemplary IDH1R132H sequencing result.

5-Bromo-2’-deoxyuridine incorporation assay (BrdU co-staining). To assess the proliferation rate, 10 μM BrdU was added to the cultures. After 48 h-14 days of incubation the tested cultures were processed for immunocytochemical BrdU co-staining. First, an immunocytochemical staining for other markers was performed as described, up to the step of PBS washing after the incubation with the secondary antibodies. Next, the cells were post-fixed in 4% paraformaldehyde and permeabilized with 0.1% Triton X-100 for 10 min at room temperature. Non-specific binding sites were blocked by the incubation with 2% donkey serum (Sigma) in PBS for 30 min. After blocking, the cells were treated with 2N HCl in 37°C for 40 min and then with 0.1 M borate buffer (pH 8.5) at room temperature for 12 min. Then, cells were incubated with mouse anti-BrdU antibody (1:500; B 8434, Sigma-Aldrich) for 1 h, washed with PBS and incubated with the appropriate secondary antibodies at room temperature for 1 h. Finally, cells were mounted with ProLong® Gold Antifade Reagent (Molecular Probes), coverslipped and examined using Nikon fluorescence microscope. For each analysis 200 nuclei were examined.

Figure 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 2.

The classical monolayer conditions. (A-C) IDH1R132H(+) cells accumulate TP53 and show GFAP expression; (D) IDH1R132H(+) cells constitute a minority even before the 1st passage; (E) αSMA-positive cells constitute the majority at passage 1st, few GFAP-positive cells can be observed. (F) GFAP-positive cells do not incorporate BrdU even before the 1st passage.

Senescence-associated (SA)-β-Gal staining. SA-β-Gal staining was performed following the protocol by Dimri et al. (11). Cells were washed three times with PBS and fixed with cold 3% paraformaldehyde for 5 min. The cells were than washed two times with PBS for 5 min. Next, a fresh senescence-associated staining solution (1 mg/mL 5-bromo-4-chloro-3-indolyl β-D-galactopyranoside, X-Gal in dimethylformamide (stock 20 mg/mL)/40 mM citric acid/sodium phosphate, pH 6.0/5 mM potassium ferrocyanide/5 mM potassium ferricyanide/150 mM NaCl/2 mM MgCl2), pre-warmed to 37°C, was added and the cells were incubated in 37°C (no CO2) for 12 h. After the incubation, the cells were washed two times with PBS for 5 min and photographed using Olympus CKX41 microscope. The percentage of the stained cells was calculated.

DNA/RNA isolation and reverse transcriptase-PCR. Total DNA and RNA were isolated from frozen tissue samples (stored at −80°C), the corresponding cell cultures and frozen leukocytes from peripheral blood obtained from patients and healthy volunteers using an AllPrep DNA/RNA Mini Kit (Qiagen), according to the manufacturer's protocol. RNA and DNA concentrations were measured spectrophotometrically. 100 ng of total RNA was reverse-transcribed into a single-stranded cDNA using a QuantiTect Rev. Transcription Kit (Qiagen) according to the manufacturer's protocol.

IDH1 sequencing analysis. Exon 4, including codon 132 of the IDH1 gene, was amplified by PCR and sequenced using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA). The primers used for PCR amplification of the DNA sequence were: GGCACCCATCTTCTGTGTTT (forward) and ATATATGCATTTCTCAATTTCA (reverse). The sequencing primer used was: GCAAAAATATCCCCCGGCTT (forward). In order to confirm the result of the sequencing a second primer was used: CGGTCTTCAGAGAAGCCATT (reverse). The sequences were analyzed with the ABI 3130 Genetic Analyzer and DNA Sequencing Analysis Software (Applied Biosystems, Foster City, CA, USA) (Figure 1D).

TP53 sequencing analysis. Exons 5 to 8 of the TP53 gene were subjected to the sequencing analysis. The primers used for the PCR amplification of cDNA sequences were: GTGCAGCTGTGGGTTGATT (exons 5-8, forward) and GCAGTGCTCGCTTAGTGCTC (exons 5-8, reverse); annealing temperature was 53°C. The sequencing primers were GCCATCTACAA GCAGTCACA (exons 5-8, forward) and CCCTTTCTTGCGGA GATTCT (exons 5-8, reverse). cDNA sequencing was performed using BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA). The sequences were analyzed with the ABI 3130 Genetic Analyzer and DNA Sequencing Analysis Software (Applied Biosystems, Foster City, CA, USA).

Figure 3.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 3.

Monolayer serum-free conditions. (A-D) GFAP(+)/TP53(+) cells constitute the majority of cells, but rarely incorporate BrdU. Similarly, GFAP(−)/TP53(−) cells do not proliferate efficiently.

Figure 4.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 4.

3-D culture conditions. (A-C) The majority of GFAP(+)/IDH1R132H(+)/TP53(+) cells in early spheroids incorporate BrdU.

Results

Firstly, we performed the screening of the 8 cases with IDH1 mutation for other concurrent molecular alterations, which resulted in TP53 mutation detection in 4 out of 8 cases. Next, we analyzed the cellular subpopulations for the co-expression of glial markers. IDH1R132H-positive cells expressed GFAP and accumulated nuclear TP53 (the cases with mutation) (Figure 2A-D). The remaining (IDH1R132H-negative) cells were also negative for GFAP and TP53; αSMA was expressed by a sub-population of these cells (Figure 2E). Sequencing analysis confirmed that αSMA-positive cells were negative for TP53 and IDH1 mutations, which indicates their stromal/non-neoplastic origin.

Figure 5.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 5.

IDH1R132H(+)/GFAP(+) cells under monolayer conditions show SA-β-Gal activity (A-D).

Next, we analyzed the cellular sub-populations under different culture conditions. Under the classical conditions IDH1R132H-positive cells did not proliferate efficiently and their number decreased rapidly. In GB such cells were detectable up to the 4th passage, while in grade II/III gliomas no longer than for 2 passages. On the other hand, the remaining (IDH1R132H-negative) population proliferated easily and, subsequently, overgrew the neoplastic cells (Figure 2F). The proliferation of GFAP(−)/TP53(−) cells and its lack in GFAP(+)/TP53(+) cells was verified with BrdU incorporation assay (Figure 2F).

The behavior of IDH1R132H-positive cells under the serum-free monolayer conditions was similar to the classical conditions in their lack of proliferation and their disappearance from the culture within the first two passages (Figure 3A–D). Conversely, such conditions inhibited the proliferation of IDH1R132H-negative cells, which did not overgrow the tumor cells (Figure 3A-D). In general, the cells proliferated more slowly under the serum-free conditions, which prolonged the periods between each passage and, therefore, the presence of the IDH1R132H-positive cells was seemingly maintained for a longer time. BrdU incorporation was rarely observed in tumor cells even after a long incubation.

In contrast to the monolayer cultures, the 3D conditions maintained the prevalence of the IDH1R132H-positive cells for 1-2 months, suppressing the stromal cells (Figure 4A-C). The proliferation of the IDH1R132H-positive cells was detectable by means of BrdU incorporation assay, which, however, required longer incubation periods; in general, 50% of fresh explant cells incorporated BrdU within about 10 days (7 days for GB spheroids), whereas the older explants (2-3 weeks old) required about 20-day incubation (14 days for GB spheroids) for the same effect. Nonetheless, even spheroids/explants from the same sample differed in terms of proliferation. Intriguingly, in cases with mutant TP53 not all IDH1R132H-positive cells accumulated TP53, and conversely, not all TP53-accumulating cells expressed IDH1R132H (Figure 4A-B). In contrast to the previously described glioblastoma spheroids, the IDH1R132H-positive ones did not allow for several month-long cultivation.

Figure 6.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 6.

3D (spheroid) culture from a glioblastoma specimen with IDH1R132H mutation. The majority of cells are SA-β-Gal-positive (A, B).

Figure 7.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 7.

Co-expression of glial and stemness markers in IDH1R132H-positive cells. (A-D) IDH1R132H(+), GFAP(+), SOX2(+) cells are present.

We observed the SA-β-Gal activity and the classical morphological changes in the most of IDH1R132H-positive cells under the monolayer conditions (Figure 5A-D), which together with their lack of proliferation detected both by BrdU incorporation assay and by real-time in vitro observation may be considered as the typical features of senescence. These features were also observable under the 3D conditions, especially in late spheroid transfers (Figure 6A-B), but even the earliest spheroids contained senescent IDH1R132H-positive cells. Additionally, we also detected the apoptosis of glioma cells under all cell culture conditions.

Finally, we analyzed the IDH1R132H-positive cells for the coexpression of neuronal, glial and stemness markers. We detected the nuclear accumulation of TP53 as well as the expression of GFAP and SOX2 together with the features of senescence (Figure 7A-D).

Discussion

The role of senescence in gliomas requires a close investigation. Thus far, it is unclear whether this process serves an anti-neoplastic role, a pro-neoplastic one or both, depending on other factors. Additionally, it may be potentially employed as the target of new therapeutic methods. Finally, senescence may be responsible for the failure in glioma cell line stabilization experiments.

Most likely, glioma cells become senescent during the classical and novel monolayer as well as 3D in vitro cell culturing, as we have recently reported (5). In this study we analyzed cell cultures originating from 8 specimens with IDH1R132H mutation. The antibodies recognizing the IDH1R132H protein offer the unmatched opportunity to identify the neoplastic cells. In general, under all conditions we observed two cellular subpopulations (varying in their proportions): IDH1R132H(+)/TP53(+)/GFAP(+)/MAP2(+)/αSMA(−), which were concluded as the neoplastic cells, and the IDH1R132H(−)/TP53(−)/GFAP(−)/MAP2(−), among which a portion was αSMA(+) and which were most probably the stromal cells. As we previously reported, the cells with the IDH1 mutation could be shortly (at most for 2 passages) observed under the classical conditions, due to their almost complete lack of proliferation (12). Here, we report data clearly linking this issue with the phenomenon of in vitro senescence: only the IDH1R132H-positive cells presented the SA-β-Gal activity and the classical morphological changes. The serum-free monolayer conditions were no more efficient in stimulating the proliferation and in protecting against senescence of such cells. In accordance with Luchman et al., we observed that under the 3D conditions the IDH1R132H-positive cells could be preserved in the proliferative state for 3-4 weeks, which was, however, not sufficient for the cell line stabilization (13). What is important, the observed senescence of neoplastic cells is not induced by any specific chemical or physical factors other than the typical (classical or novel) cell culture conditions themselves. Therefore, we refer to the observed process as spontaneous senescence. The other (non-senescent) population lacked the IDH1 and TP53 mutations (verified by both immunocytochemical and sequencing analyses). A population of non-neoplastic, stromal, αSMA-positive cells was reported in glioblastoma by Clavreul et al. (14). Apparently other glial tumors (including low grade astrocytomas) are also infiltrated by these cells, and thus, one might consider to re-define the GASC abbreviation as the Glioma-Associated Stromal Cells. The infiltrating stromal cells were easily adaptable to the classical monolayer conditions and, as a result of the expansive proliferation, overgrew the neoplastic cells. Under the monolayer serum-free conditions the proliferation of αSMA-positive cells was suppressed, which moderately prolonged the original cellular composition. Under the 3-D conditions the stromal cells constituted a minor subpopulation with a low proliferation rate. It should be also noted that other processes such as apoptosis may be observed under in vitro conditions and should not be neglected in future analyses.

Moreover, the senescent IDH1R132H-positive cells also expressed stemness markers such as SOX2. Importantly, all IDH1R132H-positive cells were SOX2-positive as well as all SOX2-positive cells were IDH1R132H-positive. Therefore, it suggests that glioma cells with the features of stemness become senescent in vitro along with other tumor cells. Interestingly, not all TP53-positive cells were IDH1R132H-positive and vice versa, but we would be hesitant to suspect genetic heterogeneity as the underlying mechanism.

Conclusion

In conclusion, the anti-IDH1R132H antibody was used to specifically confirm the in vitro senescence of glioma cells. The IDH1R132H-positive cells both were senescent and showed the expression of stemness marker (SOX2). The recognition of the mechanisms responsible for in vitro senescence of glioma cells is important from the perspective of future medical research and potential application.

Acknowledgements

This study was sponsored by National Science Center Grants No. 2012/05/B/NZ4/02623 (IDH1 analyses and cell cultures), No. 2011/03/N/NZ1/06534 (senescence analyses) and No. 2011/01/B/NZ1/01502 (TP53 analyses).

Footnotes

  • ↵* These Authors contributed equally to this study.

  • This article is freely accessible online.

  • Received February 18, 2014.
  • Revision received March 27, 2014.
  • Accepted March 28, 2014.
  • Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved

References

  1. ↵
    1. Krtolica A,
    2. Parrinello S,
    3. Lockett S,
    4. Desprez PY,
    5. Campisi J
    : Senescent fibroblasts promote epithelial cell growth and tumorigenesis: A link between cancer and aging. Proc Natl Acad Sci USA 98(21): 12072-12077, 2001.
    OpenUrlAbstract/FREE Full Text
    1. Freund A,
    2. Patil CK,
    3. Campisi J
    : p38MAPK is a novel DNA damage response-independent regulator of the senescence-associated secretory phenotype. EMBO J 30(8): 1536-1548, 2011.
    OpenUrlAbstract/FREE Full Text
    1. Chang BD,
    2. Watanabe K,
    3. Broude EV,
    4. Fang J,
    5. Poole JC,
    6. Kalinichenko TV,
    7. Roninson IB
    : Effects of p21Waf1/Cip1/Sdi1 on cellular gene expression: Implications for carcinogenesis, senescence, and age-related diseases. Proc Natl Acad Sci USA 97(8): 4291-4296, 2000.
    OpenUrlAbstract/FREE Full Text
  2. ↵
    1. Angelini PD,
    2. Zacarias Fluck MF,
    3. Pedersen K,
    4. Parra-Palau JL,
    5. Guiu M,
    6. Bernadó Morales C,
    7. Vicario R,
    8. Luque-García A,
    9. Navalpotro NP,
    10. Giralt J,
    11. Canals F,
    12. Gomis RR,
    13. Tabernero J,
    14. Baselga J,
    15. Villanueva J,
    16. Arribas J
    : Constitutive HER2 signaling promotes breast cancer metastasis through cellular senescence. Cancer Res 73(1): 450-458, 2013.
    OpenUrlAbstract/FREE Full Text
  3. ↵
    1. Stoczynska-Fidelus E,
    2. Piaskowski S,
    3. Bienkowski M,
    4. Banaszczyk M,
    5. Hulas-Bigoszewska K,
    6. Winiecka-Klimek M,
    7. Radomiak-Zaluska A,
    8. Och W,
    9. Borowiec M,
    10. Zieba J,
    11. Treda C,
    12. Rieske P
    : The failure in the stabilization of glioblastoma-derived cell lines: Spontaneous in vitro senescence as the main culprit. PLoS ONE 9(1): e87136, 2014.
    OpenUrlCrossRefPubMed
  4. ↵
    1. Pandita A,
    2. Aldape KD,
    3. Zadeh G,
    4. Guha A,
    5. James CD
    : Contrasting in vivo and in vitro fates of glioblastoma cell subpopulations with amplified EGFR. Genes Chromosomes Cancer 39(1): 29-36, 2004.
    OpenUrlCrossRefPubMed
  5. ↵
    1. Lee J,
    2. Kotliarova S,
    3. Kotliarov Li A,
    4. Su Q,
    5. Donin NM,
    6. Pastorino S,
    7. Purow BW,
    8. Christopher N,
    9. Zhang W,
    10. Park JK,
    11. Fine HA
    : Tumor stem cells derived from glioblastomas cultured in bFGF and EGF more closely mirror the phenotype and genotype of primary tumors than do serum-cultured cell lines. Cancer Cell 9(5): 391-403, 2006.
    OpenUrlCrossRefPubMed
  6. ↵
    1. Witusik-Perkowska M,
    2. Rieske P,
    3. Hulas-Bigoszewska Zakrzewska M,
    4. Stawski R,
    5. Kulczycka-Wojdala D,
    6. Bieńkowski M,
    7. Stoczyńska-Fidelus E,
    8. Greáner SM,
    9. Piaskowski S,
    10. Jaskólski DJ,
    11. Papierz W,
    12. Zakrzewski K,
    13. Kolasa M,
    14. Ironside JW,
    15. Liberski PP
    : Glioblastoma-derived spheroid cultures as an experimental model for analysis of EGFR anomalies. J Neurooncol 102(3): 395-407, 2011.
    OpenUrlCrossRefPubMed
    1. Gunther HS,
    2. Schmidt NO,
    3. Phillips HS,
    4. Kemming D,
    5. Kharbanda S,
    6. Soriano R,
    7. Modrusan Z,
    8. Meissner H,
    9. Westphal M,
    10. Lamszus K
    : Glioblastoma-derived stem cell-enriched cultures form distinct subgroups according to molecular and phenotypic criteria. Oncogene 27(20): 2897-2909, 2008.
    OpenUrlCrossRefPubMed
  7. ↵
    1. Schulte A,
    2. Gunther HS,
    3. Martens T,
    4. Zapf S,
    5. Riethdorf S,
    6. Wülfing C,
    7. Stoupiec M,
    8. Westphal M,
    9. Lamszus K
    : Glioblastoma stem-like cell lines with either maintenance or loss of high-level EGFR amplification, generated via modulation of ligand concentration. Clin Cancer Res 18(7): 1901-1913, 2012.
    OpenUrlAbstract/FREE Full Text
  8. ↵
    1. Dimri GP,
    2. Lee X,
    3. Basile G,
    4. Acosta M,
    5. Scott G,
    6. Roskelley C,
    7. Medrano EE,
    8. Linskens M,
    9. Rubelj I,
    10. Pereira-Smith O
    : A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci USA 92(20): 9363-9367, 1995.
    OpenUrlAbstract/FREE Full Text
  9. ↵
    1. Piaskowski S,
    2. Bienkowski M,
    3. Stoczynska-Fidelus E,
    4. Stawski R,
    5. Sieruta M,
    6. Szybka M,
    7. Papierz W,
    8. Wolanczyk M,
    9. Jaskolski DJ,
    10. Liberski PP,
    11. Rieske P
    : Glioma cells showing IDH1 mutation cannot be propagated in standard cell culture conditions. Br J Cancer 104(6): 968-970, 2011.
    OpenUrlCrossRefPubMed
  10. ↵
    1. Luchman HA,
    2. Stechishin OD,
    3. Dang NH,
    4. Blough MD,
    5. Chesnelong C,
    6. Kelly JJ,
    7. Nguyen SA,
    8. Chan JA,
    9. Weljie AM,
    10. Cairncross JG,
    11. Weiss S
    : An in vivo patient-derived model of endogenous IDH1-mutant glioma. Neuro Oncol 14(2): 184-191, 2012.
    OpenUrlCrossRefPubMed
  11. ↵
    1. Clavreul A,
    2. Etcheverry A,
    3. Chassevent A,
    4. Quillien V,
    5. Avril T,
    6. Jourdan ML,
    7. Michalak S,
    8. François P,
    9. Carré JL,
    10. Mosser J
    ; Grand Ouest Glioma Project Network, Menei P: Isolation of a new cell population in the glioblastoma microenvironment. J Neurooncol 106(3): 493-504, 2012.
    OpenUrlCrossRefPubMed
PreviousNext
Back to top

In this issue

Anticancer Research
Vol. 34, Issue 6
June 2014
  • Table of Contents
  • Table of Contents (PDF)
  • Index by author
  • Back Matter (PDF)
  • Ed Board (PDF)
  • Front Matter (PDF)
Print
Download PDF
Article Alerts
Sign In to Email Alerts with your Email Address
Email Article

Thank you for your interest in spreading the word on Anticancer Research.

NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.

Enter multiple addresses on separate lines or separate them with commas.
Spontaneous In Vitro Senescence of Glioma Cells Confirmed by an Antibody Against IDH1R132H
(Your Name) has sent you a message from Anticancer Research
(Your Name) thought you would like to see the Anticancer Research web site.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
3 + 4 =
Solve this simple math problem and enter the result. E.g. for 1+3, enter 4.
Citation Tools
Spontaneous In Vitro Senescence of Glioma Cells Confirmed by an Antibody Against IDH1R132H
EWELINA STOCZYNSKA-FIDELUS, WALDEMAR OCH, PIOTR RIESKE, MICHAL BIENKOWSKI, MATEUSZ BANASZCZYK, MARTA WINIECKA-KLIMEK, JOLANTA ZIEBA, KAROLINA JANIK, KAMILA ROSIAK, CEZARY TREDA, ROBERT STAWSKI, ANNA RADOMIAK-ZALUSKA, SYLWESTER PIASKOWSKI
Anticancer Research Jun 2014, 34 (6) 2859-2867;

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Reprints and Permissions
Share
Spontaneous In Vitro Senescence of Glioma Cells Confirmed by an Antibody Against IDH1R132H
EWELINA STOCZYNSKA-FIDELUS, WALDEMAR OCH, PIOTR RIESKE, MICHAL BIENKOWSKI, MATEUSZ BANASZCZYK, MARTA WINIECKA-KLIMEK, JOLANTA ZIEBA, KAROLINA JANIK, KAMILA ROSIAK, CEZARY TREDA, ROBERT STAWSKI, ANNA RADOMIAK-ZALUSKA, SYLWESTER PIASKOWSKI
Anticancer Research Jun 2014, 34 (6) 2859-2867;
Twitter logo Facebook logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • Materials and Methods
    • Results
    • Discussion
    • Conclusion
    • Acknowledgements
    • Footnotes
    • References
  • Figures & Data
  • Info & Metrics
  • PDF

Related Articles

Cited By...

  • Monoallelic IDH1 R132H Mutation Mediates Glioma Cell Response to Anticancer Therapies via Induction of Senescence
  • Sensitivity of Neoplastic Cells to Senescence Unveiled Under Standard Cell Culture Conditions
  • Google Scholar

More in this TOC Section

  • Musashi1 Enhances Cell Growth and Increases Chemoresistance in Neuroblastoma
  • 6-O-Carboxypropyl-α-Tocotrienol Enhances the Anticancer Effects of Bortezomib Without Suppressing NRF1 and NRF3 in Colorectal Cancer Cells
  • Imbalance Between CD44 and STAT3 Enhances Spheroid Viability and Impairs Pembrolizumab Response in Urothelial Cancer
Show more Experimental Studies

Keywords

  • IDH1 gene
  • glioma
  • Glioblastoma
  • Astrocytoma
  • senescence
  • 3D cell culture
Anticancer Research

© 2026 Anticancer Research

Powered by HighWire