Aberrant Expression of CXCR4 and β-Catenin in Pancreatic Cancer

Patients and Methods

Patients and tissue samples. The patients included in the study were those who underwent curative or palliative surgery for pancreatic cancer at the Department of Hepatobiliary Surgery, the First Affiliated Hospital of Medical College, Xi'an Jiaotong University, P.R. China, from August 2006 to August 2010. Forty-eight tissue samples of pancreatic ductal carcinoma were collected. Eight tissue samples of normal pancreatic tissue were obtained from patients operated on pancreatic trauma, and were verified by pathological techniques. All samples were fixed with 10% formalin, uniformly embedded with paraffin, and stained with hematoxylin-eosin (HE). The mean age of patients overall was 58.5±10.3 years, with a range of 34-76 years. Informed consent was obtained from the patients or their legal representatives before the study. The study was approved by the Institutional Ethics Committee of Xi'an Jiaotong University (No. 001003226). The clinicopathological features of patients according to the tumor-node-metastasis (TNM) stage classification of the International Union Against Cancer (UICC) are shown in Table I (23). Postoperative survival was defined as the time that elapsed from the surgery to cancer-related death. The median follow-up time was 16.2 months.

Cell line and culture conditions. Different grade human pancreatic cancer cell lines: poorly differentiated (Panc-1, Miapaca-2), moderately differentiated (BxPC-3, AsPC-1), and well-differentiated (PC-2, Capan-1) were stored at the Department of Hepatobiliary Surgery, First Affiliated Hospital of Xi'an Jiaotong University. The cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM, Invitrogen Corporation, Carlsbad, CA. USA) supplemented with 10% fetal bovine serum (FBS, Invitrogen) and penicillin (100 units/ml), streptomycin (0.1 mg/ml) at 37°C in an environment of 95% air and 5% CO₂.

Immunohistochemical staining. Four-micrometer tissue sections from each tissue sample on glass slides were deparaffinized three times in xylene for 8 min each, rehydrated three times in a graded series of ethanol, and washed with phosphate-buffered saline (PBS) (pH 7.4). The slides were treated with 3% H₂O₂ for 15 min to block endogenous peroxidase activity. These sections were heated in 0.01 M sodium citrate buffer to retrieve antigen activity and then cooled at room temperature. Primary antibodies to CXCR4 and β-catenin were obtained from eBioscience (San Diego, CA. USA) and Santa Cruz Biotechnology (Santa Cruz, CA, USA), respectively. The sections were first incubated with antibody to CXCR4 (1:50) and to β-catenin (1:200) at 4°C overnight, then incubated with biotin-labeled secondary antibody for 30 min, and finally incubated with streptavidin-peroxidase for 30 min at room temperature. The tissue sections were developed with diaminobenzidine (DAB), lightly counterstained with hematoxylin, and mounted. Negative controls were obtained by substituting the primary antibody with PBS. The evaluation of target protein was performed simultaneously by two pathologists who had no knowledge of the patients' clinicopathological features. All slides were observed under a microscope, and representative photographs were taken.

Evaluation of immunostaining and semiquantitative analysis. A refined scoring system was used for the evaluation of cytoplasmic staining results for CXCR4 and β-catenin. The immunoreactive score (IRS) was calculated according to a previous study by determining the product of the intensity of immunostaining (none=0, weak=1, moderate=2, strong=3) and the percentage of positively stained tumor cells (none=0, <10%=1, 10–50%=2, 51–80%=3, >80%=4) (24). By multiplying both these components, an expression score (0–12) was obtained. For the final statistical analysis, the IRS value of 0 was ranked as 0 (negative); IRS values 1–3, as 1 (weak expression); IRS values 4-8, as 2 (moderate expression); and IRS values 9-12, as 3 (strong expression).

Quantitative real time polymerase chain reaction (QT-PCR) to detect mRNA expression. A total of 2×10⁵ pancreatic cancer cells were harvested with Trizol Reagent (Invitrogen) to extract total RNA. cDNA synthesis was conducted as followed with the SYBR® ExScript™ RT-PCR kit (Takara Biotechnology Co. Ltd., Dalian, P.R. China) according to the manufacturer's instructions: 500 ng total RNA was mixed with 2 μl of 5× ExScript™ RTase buffer, 0.5 μl of dNTP mixture, 0.5 μl of random hexamers, 0.25 μl of ExScript™ Rtase, and 0.25 μl of RNase Inhibitor in a total volume of 10 μl. The reactions were performed at 42°C for 12 min, followed by inactivation of the reverse transcriptase at 95°C for 2 min. The cDNA was stored at −20°C. QT-PCR was performed on an ABI PRISM® 7300 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) with SYBR Green Master Mix. The final reaction volume was 25 μl and contained 12.5 μl 2× SYBR® Premix Ex Taq™, 1.0 μl of each primer (10 μM), 0.5 μl 50× ROX reference dye, and 1.0 μl cDNA. The cycling conditions were as follows: initial denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 15 s, and 60°C for 60 s. Each measurement was performed in triplicate, and no-template controls were included for each assay. After PCR, a dissociation curve analysis was conducted. Glyceraldehyde-3-phosphatedehydrogenase (GAPDH) was applied as the internal housekeeping gene. Relative gene expression was calculated using the 2^−ΔΔCT method compared to GAPDH. Primers used for GAPDH were: F: AGCCACATCGCTCAGACAC, R: GCCC AATACGACCAAATCC; for CXCR4 were: F:CTGTG AGCAGAGGGTCCAG, R: ATGAATGTCCACCTCGC TT; and for β-catenin were: F: GCTTTCAGTTGAGCTGACCA, R: AAGTCC AAGATCAGCAGTCTCA.

• Download figure
• Open in new tab
• Download powerpoint

Figure 1.

Immunohistochemical analysis showing different C-X-C chemokine receptor type 4 (CXCR4) expression levels in non-malignant pancreatic tissues (A) and pancreatic cancer tissues (B to D). A: Negative expression; B: weak cytoplasmic expression; C. moderate cytoplasmic expression; D. strong cytoplasmic expression (original magnification ×200).

Statistical analysis. All statistical tests were two-sided, and a probability value of <0.05 was considered as statistically significant. To evaluate the association between ordinal data of CXCR4 expression and β-catenin expression, the Spearman correlation coefficient was calculated. Correlation between the target protein and clinicopathological features was assessed using the Chi-square test. Survival was evaluated by the Kaplan–Meier product limit method and compared between groups using the log-rank test. Multivariate survival analysis for independent prognostic factors was performed by a Cox proportional hazards model that included significant univariate variables. A value of p<0.05 was considered statistically significant.