Abstract
Background: Double-hit lymphomas (DHL) with chromosomal rearrangements affecting the avian myelocytomatosis viral oncogene homolog (cMYC) and either the B-cell lymphoma-2 (BCL2) or -6 (BCL6) locus are uncommon neoplasms with an aggressive clinical course and dismal prognosis. Most cases exhibit a phenotype intermediate between diffuse large B-cell lymphoma (DLBCL) and Burkitt lymphoma. Recently mutations affecting the inhibitor of DNA binding 3 (ID3), a helix-loop-helix protein regulating cell cycle progression and B-cell differentiation, were identified as being molecular hallmarks in Burkitt lymphoma, with only rare mutations being found in other lymphomas with translocations affecting cMYC. Materials and Methods: In the present study, we evaluated the mutational status of ID3 in 37 cases of DHL and 16 cases of sporadic Burkitt lymphoma in order to identify a possible association of this new found hallmark with the rare and insufficiently-defined entity of DHL, seeking to broaden the understanding of these lymphomas at a molecular level. Results: We identified ID3 mutations in lymphomas with chromosomal aberrations at cMYC and either BCL2 or BCL6 at a frequency intermediate between that of DLBCL and Burkitt lymphoma, hinting at a common pathway in lymphomagenesis for a subset of patients with DHL. Conclusion: The results of this study assist in the molecular characterization of these highly aggressive lymphomas, potentially giving rise to novel therapeutic approaches.
Reciprocal chromosomal translocations are common genetic hits in B-cell non-Hodgkin's lymphomas; in particular chromosomal translocations involving the immunoglobulin genes, resulting in the juxtaposition of an oncogene to an enhancing locus, are common (14, 22). For certain types of lymphomas, the occurrence of such a chromosomal aberration is considered to be the moment of lymphomagenesis (e.g. t(8;14)(q24;q34) or variant translocations involving the avian myelocytomatosis viral oncogene homolog (cMYC) and immunoglobin (IG) loci in Burkitt lymphoma (25). Mature B-cell lymphomas carrying two or more activating chromosomal breakpoints, one of which affecting the cMYC locus, are regularly referred to as double/triple-hit lymphomas (DHL) (2). Morphologically and by means of immunohistochemistry, these cases often exhibit aspects resembling both diffuse large B-cell lymphoma (DLBCL) and Burkitt lymphoma, giving rise to the artificial and temporary entity of B-cell lymphoma, unclassifiable, with features intermediate between DLBCL and Burkitt lymphoma (B-UCL) as defined by the World Health Organization (WHO) (17, 24). Both progression of Burkitt lymphoma, primarily carrying the t(8;14)(q24;q34) translocation and secondarily acquiring a chromosomal hit affecting the B-cell lymphoma-2 (BCL2) or -6 (BCL6) locus, and indolent lymphomas with pre-existing translocations involving BCL2 or BCL6 subsequently attaining translocations affecting cMYC and an IG locus during high-grade transformation have been reported (11, 18, 23). The latter concept explains the existence of high-grade follicular lymphomas with a double-hit karyotype. From a clinical perspective, DHL patients recurrently present with advanced stage disease, with higher International Prognostic Index (IPI) at diagnosis and a frequent tendency for bone marrow and central nervous system (CNS) involvement. Patients treated with either (R-)CHOP (rituximab-), cyclophosphamide, doxorubicin, vincristine and prednisone, or high-dose chemotherapy followed by stem cell transplantation have a dismal outcome (1, 3). Possible explanations for the worse prognosis of patients with DHL compared to both cMYC+ Burkitt lymphoma and DLBCL with BCL2 and/or BCL6 translocations include both synergistic action of cMYC and BCL2/BCL6, as well as other molecular features originating from the often complex karyotype and more numerous genetic aberrations in DHL (7, 13, 21). Most cases of B-UCL are morphologically composed of architectural and cytological features intermediate between DLBCL and Burkitt lymphoma. Predominantly medium-sized, centroblast-like cells accompanied by numerous starry sky macrophages constitute the overall diffuse proliferation. The strongly elevated cellular turnover is underlined by high proliferation, as well as a significantly elevated number of apoptotic figures. Recurrent cases exhibiting classical morphology of Burkitt lymphoma or DLBCL display an atypical immunophenotype, preventing definite classification. Furthermore, there are cases with an immunophenotype consistent with a specific diagnosis but presenting with atypical morphology, warranting for specific classification. The most common immunophenotype among B-UCL resembles germinal center B-cells (GCB) with positivity for the common acute lymphoblastic leukemia antigen (CALLA/CD10), BCL6 and BCL2 (24). Inhibitors of DNA binding (ID) proteins, such as ID3 bind E proteins, such as Transcription factor-3 (TCF3) by means of their helix-loop-helix (HLH) motif and thus inhibit DNA binding (16). Through this function ID3 has been implicated in a variety of processes, including regulation of cell-cycle progression and B-cell differentiation. ID3-knockout mice show defects in humoral immunity and B-cell proliferation, and develop T-cell lymphomas (10, 15). The disruption of ID3 function was recently proposed to be a key mechanism in the pathogenesis of both sporadic and endemic Burkitt lymphoma independent of IG/cMYC translocation (19, 20). For Burkitt lymphoma, it has been shown that protein-damaging sequence variations impair the inhibitory function of ID3 on proteins of the TCF family. This regulatory defect is underlined by the fact that most ID3 missense mutations in cases of Burkitt lymphoma affect conserved protein residues in the HLH motif (19, 20). It has been reasoned that recurrent mutations affecting the ID3-TCF3 regulatory loop with consecutive tonic B-cell signaling pose targets for novel therapeutic approaches, especially for older patients or patients in developing countries for whom the established therapeutic protocols cannot be effectively applied. In the present study, we aimed to elucidate whether or not this oncogenic mechanism is of relevance in the different subtypes of Double-hit lymphoma as current therapeutic strategies for this entity remain widely insufficient, necessitating the search for targeted therapy regimens.
Materials and Methods
Patients. Formalin-fixed and paraffin-embedded (FFPE) tissue biopsy samples from 16 patients with sporadic Burkitt Lymphoma and 37 patients with at least a chromosomal double-hit constellation were retrieved from the registry of the Reference Center for Lymph Node Pathology and Hematopathology, University Hospital of Schleswig-Holstein, Campus Luebeck. Of the latter 17 cases presented with both cMYC and BCL2 rearrangement and 16 cases showed cMYC and BCL6 rearrangement. Four cases revealed aberrations in all three loci (triple-hit).
All samples were collected as part of standard clinical care, and all studies were approved by the Ethics Commission at the University of Luebeck and are in accordance with the Declaration of Helsinki (file no. 13-077A). All cases were re-assessed for independent pathology review by two experienced hematopathologists without knowledge of the mutation status.
Immunohistochemistry. Immunohistochemical studies were performed on FFPE sections according to a standard, three-step immunoperoxidase technique using AN automated TechMate system (DAKO, Glostrup, Denmark) and the BrightVision Kit (ImmunoLogic, Duiven, the Netherlands). In addition to hematoxylin and eosin (HE), Giemsa, Gomori and periodic acid-Schiff (PAS) stains immunohistochemical stains for CD3, CD5, CD10, CD20, CD23, BCL2, BCL6, Interferon regulatory factor 4 (IRF4/MUM1) and Ki67 (MIB1) were evaluated when available. Staining results were evaluated qualitatively for CD3, CD10, CD20, CD23, BCL2, BCL6 and IRF4, whereas Ki67 and CD5 (in cases of coexpression) staining was detected quantitatively.
Fluorescence in situ hybridization (FISH) for cMYC, BCL2 and BCL6. Chromosomal breakpoints were analyzed by means of FISH using dual-color break-apart probes for 8q24 (cMYC), 18q21 (BCL2) and 3q27 (BCL6) (Abott Vysis, Des Plaines, IL, USA) according to the manufacturer's instructions.
Sequencing of ID3. Genomic DNA was obtained from FFPE specimens using the QiaAmp mini kit 250 (Qiagen, Hilden, Germany) according to the manufacturer's instructions. Following DNA extraction, the coding exons of ID3 were amplified by polymerase chain reaction (PCR) using primers as follows: ID3 exon1-F: caggcaggctctataagtgac, ID3 exon1-R: ctgcaggtc gagaatgtagtc, ID3 exon2-F: cgagaggcactcagcttagc, ID3 exon2-R: ctgccaactccaggacttgcc.
Success of the amplification was assessed by gel electrophoresis and subsequently bidirectional Sanger sequencing was performed using a CEQ 8800 platform (Beckman & Coulter, Pasadena, CA, USA). Known single-nucleotide polymorphisms were excluded from further analysis.
Statistical analysis. Statistical data analyses were performed using GraphPad Prism 5. In order to determine statistically significant differences in mutation frequency between different subsets of patients the Fisher's exact test was applied. All analyses were two-sided and the statistical significance level was set to 5% (α≤0.05).
Results
Histopathological and immunophenotypic features of the study group. The majority of the DHL cases shared similar morphological features in both nodal and extranodal sites. By means of morphological and immunohistochemical investigations and in accordance with the WHO Classification of lymphoid malignancies 20 cases (66%) were classified as B-UCL and 10 cases had a DLBCL phenotype with no trend for predominance of the former or the latter with regard to the different types of double-hit constellations (24). Curiously, all DHL appeared to be of germinal center origin as assessed in accordance with the classification algorithm proposed by Hans et al. (6). Due to highly recurrent tingible-body macrophages a ‘starry sky’ pattern could be observed in most of the cases which were composed of diffuse sheets of predominantly medium-sized, centroblast-like B-cells with multiple small nucleoli (Figure 1a and 2a). All cases showed immunoreactivity for CD20. Compared to cases of sporadic Burkitt lymphoma, we observed a highly elevated degree of pleomorphism and variation in size and nuclear shape (Figure 1b and c; Figure 2b and c). Symbolizing the high cellular turnover and the highly aggressive clinical behavior, mitosis and apoptotis were frequent, correlating with a high expression of Ki67 (mean expression level 84% for cMYC+/BCL2+ and 86% for cMYC+/BCL6+ DHL) (Figure 1c and d; Figure 2c and d). All cases, in which a BCL2 gene rearrangement was detected by means of flourescence in situ hybridization, showed immunohistochemical reactivity for BCL2, which was elevated in all but two cases. Furthermore, BCL6 immunohistochemical expression was found to be elevated in 12/15 cases with chromosomal imbalances affecting the 3q27 region. All cases investigated for the presence of Epstein-Barr virus by means of chromogene in situ hybridization tested negatively (0/6). Immunohistochemical findings are briefly summarized in Table I.
Immunohistochemical features of double-hit lymphomas included in the study group. Immunohistochemical studies were performed on formalin-fixed paraffin-embedded (FFPE) sections according to a standard, three-step immunoperoxidase technique using the automated TechMate system (DAKO, Glostrup, Denmark) and the BrightVision Kit (ImmunoLogic, Duiven, the Netherlands).
Mutations of the ID3 gene are recurrent events in DHL. ID3 was strongly expressed in all samples investigated in the current study and PCR products for both exons were successfully amplified in every case. Moreover, bi-directional sequencing was successful in all cases. ID3 was shown to harbor mutations at the highest frequency in cases of Burkitt lymphoma (7/16; 44%) We recorded two non-sense mutations and five missense mutations. Furthermore, we demonstrated that ID3 mutations are frequent events in both types of DHL (cMYC and BCL2 translocated, cMYC and BCL6 translocated) with 3/14 and 4/16 mutations respectively (21%/25%). Location and type of mutation are summarized in Figure 3. The singular case of triple-hit lymphoma showed wild-type ID3. There was no significant association between mutational status and dissemination of the disease with regard to nodal/extranodal involvement. Moreover, no statistically significant association between mutational status and history of prior or concurrent low-grade lymphoma was observed. Cytogenetic and morphological features, as well as ID3 mutation status and epidemiological data for the study group are summarized in Table II.
Morphological and immunohistochemical findings in a avian myelocytomatosis viral oncogene homolog translocated (cMYC+) and B-cell lymphoma-2 translocated (BCL2+) double-hit lymphoma: The retroperitoneal biopsy reveals a dense lymphatic infiltrate with homogeneously high expression of CD20. The tumor is predominantly composed of blast-like B-cells exhibiting a high degree of pleomorphism and frequently intermingled macrophages forming a starry sky pattern. Cellular turnover is strongly elevated with recurrent mitotic and apoptotic figures and immunohistochemical staining for Ki67 (MIB1) reveals nuclear positivity in more than 95% of the neoplastic cells. a: Hematoxylin & Eosin staining ×25; a inset: CD20 ×200; b: Hematoxylin & Eosin stain ×400; c: Giemsa stain ×400; d: Ki67 (MIB1) ×200.
Discussion
DHL are uncommon, representing about 1% of all lymphomas and approximately 4% of high-grade B-cell lymphomas (5, 12). Most studies regarding this entity have focused on B-cell lymphomas harboring both cMYC re-arrangement as well as chromosomal abnormalities affecting BCL2 and only few cases of cMYC+/BCL 6+ DHL have been published to date (18). For DHL, especially those harboring cMYC+/BCL2+, a broad spectrum of morphological findings has been reported, with the majority of cases being classified as B-UCL (2, 24). With regard to this morphological and immunophenotypic spectrum, recognition and classification of DHL has been difficult and it is currently believed that they may have been underdiagnosed in the past (4, 12). A substantial subset of cases can be classified as DLBCL and rare cases have been classified as (high-grade) follicular lymphoma, B-lymphoblastic lymphoma, and composite lymphoma (11). Previous studies uniformly revealed patients with cMYC+/BCL2+ lymphomas to have a number of poor prognostic features and a more recent study extended most of these findings to cMYC+/BCL6+ lymphomas (8, 9, 18, 23, 26). These prognostic features frequently included a high serum lactate dehydrogenase level at diagnosis, a high frequency of bone marrow involvement and multiple extranodal sites of involvement. Additionally CNS disease was also common and most patients had a high IPI. The presence of previous or concurrent low-grade follicular lymphomas constituted an independent marker of poor prognosis, wheras stratification into WHO classification categories did not correlate significantly with prognosis. In a recently published series of six cases, cMYC+/BCL6+ double-hit lymphomas were reported to have morphologically uniform features consistent with the WHO entity B-UCL, although the authors recognized a bias that may be of relevance to the study presented here, as well as the cases selected for these studies were more likely to have cytogenetic FISH studies conducted due to their morphologically- and/or immunohistochemically-suspicious presentation compared with cases of classical DLBCL or other defined entities (18). Pan et al. first proposed a role for ID3 in mediating signals from the B-cell receptor to cell-cycle progression during humoral immune responses (15). Given this key regulatory function, it was later concluded that mutations affecting ID3 may result in tonic B-cell receptor signaling, leading to a cMYC-independent mechanism of lymphoid proliferation in Burkitt lymphoma (19, 20). These observations were further in accordance with a predisposition of ID3 knock-out mice for lymphomagenesis as described by Li et al. (10). In this study, we report that ID3 mutations are recurrent events in both cMYC+/BCL2+ as well as cMYC+/BCL6+ DHL adding further evidence to the hypothesis that the biological behaviour of this rare entity has features intermediate between Burkitt lymphoma and DLBCL. Our data may hint at a subset of DHL sharing a molecular hallmark of Burkitt lymphoma in lymphomagenesis. We observed a trend towards patients with Burkitt lymphoma with ID3 mutations being younger than patients with wild-type ID3. This trend, however, failed to reach statistical significance due to the small size of our study group (p=0.1120). No such correlation was found for DLBCL and/or B-UCL. In accordance with the literature, the frequency of missense mutations was highest within the evolutionarily-conserved regions containing the HLH domain. Considering the dismal prognosis of DHL and the potential therapeutical options targeting ID3 or consecutive tonic B-cell signaling, we believe that the involvement of ID3 mutations may be of interest for future, targeted therapy approaches. In summary, our findings, alltough limited by a small sample size, indicate an oncogenic relevance of ID3 mutation in a subset of DHL (both cMYC+/BCL2+ and cMYC+/BCL6+) patients and characterize the ID3 TCF3 regulatory loop as a potential therapeutic target in this highly aggressive entity. Moreover we described and characterized 16 new cases of cMYC+/BCL6+ DHL.
Morphological and immunohistochemical findings in a avian myelocytomatosis viral oncogene homolog translocated (cMYC+) and B-cell lymphoma-6 translocated (BCL6+) double-hit lymphoma: The histological architecture of the lymph node is entirely dissolved by a dense lymphatic infiltrate with strong reactivity for CD20 (a and inset). A starry sky pattern due to frequently intermingled macrophages can be seen as well as a high degree of pleomorphism in the neoplastic B-cell population with frequent nucleoli and strong variations in nuclear size. Cellular turnover is elevated with numerous mitotic figures and apoptotic bodies. Immunohistochemical staining for Ki67 (MIB1) reveals nuclear positivity in about 90% of the malignant B-cells. a: Hematoxylin & Eosin stain ×25; a inset: CD20 ×200; b: Hematoxylin & Eosin stain ×400; c: Giemsa stain ×400; d: Ki67 (MIB1) ×200.
Spectrum and distribution of Inhibitor of DNA binding 3 (ID3) mutations in Burkitt lymphomas and double-hit B-cell lymphomas. AA, Amino acid.
Epidemiological and cytogenetical features of the study group.
Acknowledgements
We thank Tanja Oeltermann for her skilled and dedicated technical assistance.
- Received September 6, 2013.
- Revision received October 11, 2013.
- Accepted October 15, 2013.
- Copyright© 2013 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved
References
In this issue
Jump to section
Related Articles
Cited By...
- The 2016 revision of the World Health Organization classification of lymphoid neoplasms
- Impact of MYC on malignant behavior
- Diagnosis of 'double hit' diffuse large B-cell lymphoma and B-cell lymphoma, unclassifiable, with features intermediate between DLBCL and Burkitt lymphoma: when and how, FISH versus IHC
- MicroRNA Signatures in Subtypes of Follicular Lymphoma