Abstract
Background: The purpose of this study was to investigate the role of Nucleus accumbens-associated 1 (NAC1) in the development of uterine sarcomas. Materials and Methods: NAC1 expression and localization in the normal myometrium, benign leiomyoma, and uterine sarcoma were assessed with immunohistochemistry. NAC1-specific siRNA was used to inactivate NAC1 for in vitro biological assays. Results: Almost all cases of uterine sarcoma were found to overexpress NAC1. Expression of NAC1 was significantly higher in uterine sarcomas than in benign leiomyomas (p<0.0001). NAC1 gene knockdown inhibited cell growth and induced apoptosis in SKN, a leiomyosarcoma cell line, and in OMC-9, an endometrial stromal sarcoma cell line, both of which overexpress NAC1. Conclusion: Uterine sarcomas with NAC1 overexpression are clinically the most aggressive, chemoresistant, and radioresistant tumors. Therefore, detection of NAC1 overexpression in uterine sarcomas may identify patients who will benefit from NAC1-targeted therapy.
Uterine sarcomas are rare tumors that account for approximately 1% of female genital tract malignancies and 3 to 7% of uterine cases (1). Despite intensive treatment, local recurrence and distant metastasis are common. Overall survival is poor: 5-year survival rates are 50-70% for patients with stage I disease and 0-20% for those with the remaining stages (2, 3). Uterine sarcoma is comprised of three main pathological subgroups: carcinosarcoma (formerly known as malignant mixed Mullerian tumor) (50%), leiomyosarcoma (30%), and endometrial stromal sarcoma (15%). Total abdominal hysterectomy with bilateral salpingo-oophorectomy, and debulking of the tumor if present outside the uterus, is the standard initial treatment. The benefit of adjunctive chemotherapy and radiotherapy is in question (3-5). Some patients may respond to hormonal treatment. Because sarcomas are neither highly chemosensitive nor radiosensitive, the outlook for patients with these tumors is unfavorable (4). Accordingly, other novel therapeutic agents need to be evaluated.
In an effort to elucidate the molecular etiology of chemoresistance and radioresistance, we earlier identified and characterized nucleus accumbens-1 (NAC1) as a candidate gene for chemoresistance and radioresistance in ovarian and cervical cancer (6-8). NAC1 is a nuclear protein belonging to the bric-a-brac tramtrack Broad complex/poxvirus and zinc finger (BTB/POZ) domain family. NAC1 was originally identified and cloned as a novel transcript from the nucleus accumbens, a unique forebrain structure involved in reward motivation and addictive behaviors (9-11), and it was later shown to be involved in the acute behavioral and neurochemical responses to psychomotor stimulants (11). In human cancer, NAC1 is up-regulated in several types of neoplasms, including high-grade ovarian serous carcinoma, pancreatic carcinoma, colorectal carcinoma, breast carcinoma, renal cell carcinoma, hepatocellular carcinoma, and cervical cancer (6, 7). High levels of NAC1 expression correlate with tumor recurrence in ovarian serous carcinoma, and intense NAC1 immunoreactivity in primary ovarian tumors predicts early recurrence (6, 8). Additionally, NAC1 expression is related to taxol resistance in advanced stage ovarian cancer (8, 12).
Despite its predictive value in other types of gynecological tumors, NAC1 expression has not yet been investigated in uterine sarcoma, the most aggressive malignant gynecological tumor. The purpose of this study was to investigate the role of NAC1 in the development of uterine sarcoma and its potential as a therapeutic target in this type of cancer.
Materials and Methods
Tissue samples. A total of 65 paraffin-embedded tissue samples were obtained from the Department of Obstetrics and Gynecology at the Shimane University Hospital, which includes eight carcinosarcomas, four leiomyosarcomas, two endometrial stromal sarcomas, one adenosarcoma, one osteosarcoma, one rhabdomyosarcoma, one solitary fibrous tumor, one smooth muscle tumor of uncertain malignant potential (STUMP), 36 leiomyomas, and 10 normal uterine tissue samples. Patients with uterine sarcoma had received appropriate therapy at the Shimane University Hospital between January 1998 and December 2010. Acquisition of tissue specimens and clinical information was approved by the Institutional Review Board of Shimane University. Uterine sarcomas were classified according to the surgical staging system of the International Federation of Gynecology and Obstetrics (FIGO) (13). Invasive sarcomas were divided into nine cases of stage I disease, five of stage III disease, and five of stage IV disease; there were no cases of stage II. All tumors were histologically classified according to World Health Organization criteria. The median patient age was 60 years (range=36-77 years). Thirty-six paraffin-embedded uterine leiomyoma samples were obtained from the Department of Obstetrics and Gynecology at the Shimane University Hospital. All tumors were taken from patients who had undergone hysterectomy for uterine leiomyoma.
Immunohistochemistry. Immunohistochemistry was performed on deparaffinized sections using the NAC1 antibody at a dilution of 1:100 (Novus Biologicals, Littleton, CO, USA) and an EnVision+System peroxidase kit (DAKO, Carpinteria, CA, USA). After antigen retrieval in a sodium citrate buffer, slides were incubated overnight at 4°C with the antibody. The slides for all samples were evaluated with a light microscope by two researchers. The antibody staining intensity was then analyzed in the stroma using the HSCORE (14) with modifications. This modified HSCORE was calculated as follows: HSCORE=ΣPi(i), where i is the intensity of staining (0=undetectable, 1=weakly positive, 2=moderately positive, 3=intensely positive) and PI is a score that is based on the percentage of stained cells for each intensity, ranging from 0-100%. Tissues with HSCORE more than 100 were considered as having a NAC1 overexpression.
Cell culture. The endometrial stromal sarcoma cell line OMC-9 was provided by Dr. Takashi Yamada (Osaka Medical University, Takastuki Japan) (15). The uterine leiomyosarcoma cell line STN was obtained from Riken Bioresource Center (Ibaragi, Japan). All cells were maintained in Dulbecco's Modified Eagle Medium (DMEM) (Life Technologies, Gaithersburg, MD, USA), supplemented with 10% fetal bovine serum, 100 units/ml of penicillin, and 100 μg/ml of streptomycin.
siRNA knockdown of NAC1 gene expression. Two small-interfering RNA (siRNAs) that targeted NAC1 were designed, with sense sequences of UGAUGUACACGUUGGUGCCUGUCACCA and GAGGAAGAACUCGGUGCCCUUCUCCAU. Control siRNA (luciferase siRNA) was purchased from IDT (Coralville, IA, USA). Cells were seeded into 96-well plates and transfected with siRNAs using oligofectamine (Invitrogen, Carlsbad, CA, USA). Cell numbers were determined indirectly by 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay 72 h after transfection with siRNA (16). Data were expressed as the mean±SD from triplicates. 5-bromo-2’-deoxyuridine (BrdU) uptake and staining were measured using a cell proliferation kit (Amersham, Buckinghamshire, UK), and apoptotic cells were detected using an Annexin V staining kit (Bio Vision, Mountain View, CA, USA). The percentages of BrdUrd-positive and annexin V-positive cells were determined by counting approximately 400 cells from each well in the 96-well plates. Data were expressed as the mean±SD from triplicates.
NAC1 immunostaining in uterine sarcoma.
Western blot analysis. Cell lysates were prepared by dissolving cell pellets in Laemmli sample buffer (Bio-Rad, Hercules, CA, USA) supplemented with 5% beta-mercaptoethanol (Sigma, St. Louis, MO, USA). Western blot analysis was performed on normal endometrial cultures. Similar amounts of total protein from each lysate were loaded and separated on 10% Tris-glycine-SDS polyacrylamide gels (Novex, San Diego, CA) and electroblotted to Millipore Immobilon-P polyvinylidene difluoride membranes. The membranes were probed with the NAC1 antibody (1:100) followed by a peroxidase conjugated anti-mouse immunoglobulin (1:10,000). The same membrane was probed with an antibody that reacted with Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) for loading control. Western blots were developed by chemiluminescence (Pierce, Rockford, IL, USA).
Statistical analysis. Results are expressed as the mean±SEM. Student's t-test (for the comparison of two groups) was used to evaluate numerical data. A value of p<0.05 was considered statistically significant.
Results
Table I summarizes the relationship between clinicopathological findings and the expression of NAC1 in uterine sarcomas. Interestingly, in almost all cases, the uterine sarcomas overexpressed NAC1. Immunohistochemistry for NAC1 in the uterine sarcoma sections produced strong staining of the nuclei (Figure 1). Expression of NAC1 was significantly higher in uterine sarcomas than in benign leiomyomas (p<0.0001) (Figure 2).
Immunoreactivity of Nucleus accumbens-associated protein 1 (NAC1) in uterine sarcoma samples. Intense immunoreactivity is evident in the nuclei of uterine leiomyosarcoma cells. A: A case with strong staining for NAC1 in uterine leiomyosarcoma cells. B: NAC1 immunointensity is negative in uterine leiomyoma cells.
Since uterine sarcomas overexpress NAC1, we tested whether NAC1 might represent a therapeutic target. NAC1 overexpression was seen in both the uterine leiomyosarcoma cell line SKN and the endometrial stromal sarcoma cell line OMC9 (Figure 3A). NAC1 siRNA was applied to the culture medium of SKN and OMC9. NAC1 siRNA treatment significantly reduced NAC1 protein expression compared with control siRNA treatment (Figure 3B). NAC1 siRNA also reduced the cell numbers of SKN and OMC9 cells significantly compared with control siRNA (Figure 3C) (p<0.05). The inhibition of cell growth following repression of NAC1 expression in SKN and OMC-9 likely resulted from the induction of apoptosis. The percentage of apoptotic cells identified using annexin V staining was significantly increased in the NAC1 siRNA-treated cells compared to the control siRNA-treated cells (Figure 3D). We also measured the percentage of BrdUrd-labeled cells to estimate proliferation. We found that NAC1 siRNA also reduced cellular proliferation in these two cell lines (Figure 3E).
Discussion
The current study delivers two major findings. Firstly, almost all cases of uterine sarcoma exhibited overexpression of NAC1 by immunohistochemistry. Secondly, uterine leiomyoma, a benign tumor of smooth muscles of the normal uterus (data not shown), did not express NAC1 in almost all cases. Thus, NAC1 may represent a potential therapeutic target in uterine sarcoma. Uterine sarcomas are a group of rare tumors that provide considerable challenges regarding their treatment. Surgery is the primary treatment method in cases of uterine sarcoma: extrafascial hysterectomy with pelvic lymph node sampling, with or without salpingo-oophorectomy. The use of adjuvant therapies is highly variable, and the response rates are low, as a result of low sensitivity to chemotherapy, radiation, and hormone therapy. The prognosis in cases of uterine sarcoma is dismal: overall 5-year survival varies from 17.5% to 53% in recent reports (17-22). Therefore, identification of new molecular targets in uterine sarcoma is urgent.
Immunoreactivity of Nucleus accumbens-associated protein 1 (NAC1) in uterine sarcoma is significantly higher than that in uterine leiomyoma (p<0.0001).
Effects of Nucleus accumbens-associated 1 (NAC1) knockdown on cell proliferation and apoptosis of uterine sarcoma cell lines. A: Western blot analysis showing a higher expression level of NAC1 protein in SKN and OMC-9 cells. B: Western blot analysis showing a significant reduction of NAC1 protein in NAC1 siRNA-treated cells compared with control siRNA-treated SKN and OMC-9 cells. C: NAC1 siRNA significantly reduced cell numbers in SKN and OMC-9 cells, *p<0.05. D: Detection of apoptotic cells. The experiment was performed 72 h after treatment with NAC1 siRNA or control siRNA. Treatment with NAC1 siRNA increased apoptosis of SKN and OMC-9 cells, as measured by annexin V staining, *p<0.01. E: Proliferation was estimated by counting BrdUrd-stained cells under a fluorescence microscope. Treatment with siRNA reduced DNA synthesis as measured by BrdUrd uptake. *p<0.05.
Reduction of NAC1 expression resulted in apoptosis in NAC1-expressing uterine sarcoma cell lines, indicating that NAC1 is essential for proliferation and survival of these cell lines. These results are similar to the results obtained in our previous experiments on ovarian and cervical cancer cell lines (6, 7). These findings suggest that NAC1 is a gene with significant cell growth and survival effects in uterine sarcoma. To date, there are few potential therapeutic molecular targets in uterine sarcoma (23-25). Taken together, these observations may have an impact on the clinical management of uterine sarcomas. Uterine sarcoma with overexpression of NAC1 may be considered for NAC1-targeted therapies in conjunction with current conventional chemotherapy or radiation therapy.
To our knowledge, this is the first report to suggest that overexpression of the NAC1 protein is found in uterine sarcomas, and the results of our in vitro NAC1-silencing study indicate that NAC1 is a potential therapeutic target in uterine sarcoma. This study is limited by its small size, owed to the relative rarity of uterine sarcoma. Larger sample size studies are needed to confirm our findings and to fully explore the role of NAC1 in uterine sarcoma behavior.
Acknowledgements
This study was supported by grants from the Ministry of Education, Culture, Sports, Science and Technology in Japan, Suzuken Memorial Foundation and Takeda Science Foundation.
Footnotes
-
↵* These Authors contributed equally to this study.
-
Conflict of Interest Statement
The Authors declare that there are no conflicts of interest.
- Received May 16, 2012.
- Revision received July 27, 2012.
- Accepted August 1, 2012.
- Copyright© 2012 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved
References
In this issue
Jump to section
Related Articles
Cited By...
- No citing articles found.