Investigation of a Bacterial Pore-forming Chimera Toxin for Application as a Novel Drug-delivery System Tool

Materials and Methods

Construction of expression vectors for recombinant chimera proteins. The expression vector for the recombinant chimera protein as a model DDS tool (designated as His-LTBP-CDC(ss)^IP, Figure 1) was constructed using pQE-1 (QIAGEN, Hilden, Germany) with a modified multi-cloning site, BamHI-ApaI-SalI-SacI-EcoRI-PstI-SmaI-SfiI-NotI-SphI. The DNA fragments encoding LTBP (14) and the chimera CDC were prepared as described below then inserted into the vector at the BamHI-SphI site. Briefly, the insert encoding LTBP was prepared by a cassette ligation method using six oligonucleotides (GATCCGATGACGGTCTGC, TGCGTTGCAGA CCGTCATCG, AACGCATCACAGCGTCAAGCACACGCACAG, C G T A G C C T G T G C G T G T G C T T G A C G C T G T G A, GCTACGGCTGTATCGCTTGC, GGCCGCAAGCGATACAGC) and the resultant fragment had the BamHI site in the 5’-end and the NotI site at the 3’-end. The other insert encoding chimera CDC was prepared as follows. Amplification and introduction of two point mutations, G83C and S217C, of the fragment encoding a region from 1D to 3D of ILY was carried out by polymerase chain reaction (PCR) with the cloned ily gene from S. intermedius UNS46 (GenBank ID: AB029317) as a template. The fragment encoding 4D of Sm-hPAF was also amplified with the cloned sm-hpaf gene from S. mitis Nm-65 (GenBank ID: AB051299) as a template. These fragments were joined by fusion PCR and the resultant fragment encoding the chimera CDC had the NotI site at the 5’-end and the SphI site at the 3’-end. The fragments with proper restriction sites (BamHI-NotI for LTBP fragment and NotI-SphI for the chimera CDC fragment) were inserted into the BamHI-SphI double-digested vector. In addition, the expression vector for a reference molecule His-CDC(ss)^IP, lacking the LTBP part in His-LTBP-CDC(ss)^IP, was also constructed. After confirmation of the DNA sequence of the constructed vectors, Escherichia coli DH5α Z1 was transformed by each vector and the expression of recombinant chimera proteins was confirmed by sodium dodecylsulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and Coomassie Brilliant Blue R-250 (CBB) staining of transformants after isopropyl-β-D(−)-thiogalactopyranoside (IPTG)-induction.

Expression and purification of recombinant chimera proteins. The expression of His-tagged recombinant chimera proteins, designated as His-LTBP-CDC(ss)^IP and His-CDC(ss)^IP in log-phase bacteria, were induced by incubation with IPTG (final concentration 0.1-1.0 mM) in Luria-Bertani (LB) broth containing 50 μg/ml ampicillin, for 3 to 4 h. Purification of the proteins was conducted by standard nickel-affinity chromatography of the bacterial cell lysate. Briefly, bacterial cells were washed with phosphate-buffered saline (PBS), re-suspended in sonication buffer [PBS, containing 20% sucrose, 1 mM EDTA and 2 mg/ml lysozyme, or 20 mM sodium phosphate buffer (pH 7.4) containing 20 mM imidazole and 500 mM NaCl] and sonicated under cooling in an ice bath. The cell lysate was centrifuged (8,600 ×g, 10 min, 4°C) and the supernatant was applied to nickel-affinity chromatography column using Ni-NTA agarose (QIAGEN) or HisTrap HP (GE Healthcare, Buckinghamshire, England). The purity of the recovered His-tagged recombinant proteins was checked by CBB staining after SDS-PAGE, and the concentration of the purified proteins was determined using Bradford reagent (Bio-Rad, Hercules, CA, USA).

Evaluation for membrane-binding capacity of recombinant chimera proteins. The preparation of erythrocyte membrane was conducted as follows: human erythrocytes (from healthy volunteers) washed with PBS, were lysed by suspension in 5 mM Tris-HCl (pH 7.5), then washed five times with the same hypotonic buffer, and re-suspended in PBS. The purified His-tagged recombinant chimera proteins were incubated with or without erythrocyte membranes at 37°C for 1 h, then centrifuged (13,200 ×g, 10 min, 4°C). The resultant supernatant and pellet were electrophoresed by SDS-PAGE, blotted onto polyvinylidene difluoride (PVDF) membrane and the chimera proteins were detected by a monoclonal antibody against 1D-3D of ILY previously prepared in our laboratory.

Controlled pore-formation under reduced conditions. The hemolytic activity of His-LTBP-CDC(ss)^IP, was assayed in PBS containing 0.5% (v/v) of human erythrocytes and 10 mM dithiothreitol (DTT). After incubation at 37°C for 1 h and centrifugation, the OD₅₄₀ of the supernatant was measured in a microplate reader (Model 550; Bio-Rad), and the hemolytic activity was calculated as previously described (8). For evaluation of the hemolytic properties under physiological reducing conditions, the hemolytic activity was also measured under the presence of reduced-glutathione (GSH).

Cell-targeting ability of His-LTBP-CDC(ss)^IP. In order to prepare a DDS model, Nile-Red-labeled human erythrocytes were incubated with His-LTBP-CDC(ss)^IP at 37°C for 1 h in PBS containing 1% bovine serum albumin (BSA). The Nile-Red labeled human erythrocytes were prepared as follows: Human erythrocytes washed with PBS were incubated with PBS containing 50 μM Nile-Red at room temperature for 30 min. The labeled erythrocytes were washed three times with PBS then twice with PBS containing 1% BSA, and re-suspended in PBS containing 1% BSA for the binding experiment.

Both human lung carcinoma cell line A549 (RCB0098; Riken Bioresource Center, Tsukuba, Japan) and a human normal fibroblast cell line NB1RGB (RCB0222; Riken Bioresource Center) were cultured in Dulbecco's modified eagle's medium (DMEM) containing 10% fetal bovine serum and antibiotics (penicillin G and streptomycin) at 37°C under 5% CO₂. These cells were inoculated into 6-well cell culture plates at 2×10⁵ cells/well for A549 and 1×10⁵ cells/well for NB1RGB respectively, and were cultured for 48 h. The erythrocytes bound to His-LTBP-CDC(ss)^IP were added to the cells and were incubated for 1 h, then washed three times with PBS. The cells were observed using a fluorescence microscope (Axiovert 135; ZEISS, Oberkochen, Germany) and recorded by a digital camera (DXM 1200; Nikon, Tokyo, Japan).

Functional assessment of a prototype DDS. Cholesterol-containing di-palmitoylphosphatidylcholine (DPPC) liposomes including fluorescent dye were prepared as follows: Briefly, equimolar DPPC (Avanti, Alabaster, AL, USA) and cholesterol (Wako, Osaka, Japan) were dissolved in chloroform, then coated as a thin-layer on an eggplant flask by evaporation of the chloroform under reduced pressure. PBS containing 10 mM sodium fluorescein (uranine) was added to the eggplant flask and the PBS was sonicated at about 60°C to form multilamellar vesicles (MLV). After five to six cycles of freeze–thawing of the MLV suspension, unilamellar vesicles (ULV; liposome) were prepared using a mini-extruder (Avanti) equipped with a 100 nm pore-size membrane filter (Whatman, Kent, England). Unincorporated fluorescent dye was removed by gel filtration on a Sephadex G50 column (GE Healthcare), and the liposome fractions were ultra-centrifuged (40,000 ×g) at 4°C for 30 min in an Optima TL (Beckman, Brea, CA, USA), and the fluorescent liposomes recovered were re-suspended in PBS. Subsequently, in order to bind His-LTBP-CDC(ss)^IP to the fluorescent liposomes, they were incubated together in PBS at 25°C for 30 min. After incubation, the fluorescent liposomes bound to His-LTBP-CDC(ss)^IP (designated as a prototype DDS) were harvested by ultra-centrifugation (40,000 ×g) at 4°C for 30 min and were re-suspended in DMEM.

A549 cells were inoculated into a 24-well cell culture plate at 5×10³ cells/well and cultured for 48 h. The prototype DDS was added to the cultured cells which were then incubated for 2 h, then washed with PBS. After interaction, the cells were fixed with 4% paraformaldehyde in PBS for 15 min at room temperature. Observation of the samples after PBS washing was conducted using a fluorescence microscope (Axiovert 135; ZEISS) and recorded by a digital camera (DXM 1200; Nikon).