Research ArticleExperimental Studies

Oxidative Stress Reduces Na+/H+ Exchange (NHE) Activity in a Biliary Epithelial Cancer Cell Line (Mz-Cha-1)

CHRISTOPH ELSING, AGNIESZKA VOSS, THOMAS HERRMANN, IRIS KAISER, CHRISITAN A. HUEBNER and THORSTEN SCHLENKER
Anticancer Research February 2011, 31 (2) 459-465;

Abstract

In cholangiocarcinogenesis, chronic inflammation and oxidative stress play a key role. The Na+/H+ exchanger (NHE) forms a potential link between control of intra- and pericellular pH and tumor development. Therefore, the effects of oxidant stress were determined by the use of tert-butyl hydroperoxide (t-BOOH) on Na+/H+ exchange in a biliary epithelial cancer cell line (Mz-Cha-1). The cells were exposed to the hydroperoxide and the rate of recovery from acidosis was determined by the use of the pH-sensitive fluorochrome 2’,7’-bis(carboxyethyl)-5(6)-carboxyfluorescein acetoxymethyl ester (BCECF/AM). t-BOOH reduced Na+/H+ exchange activity in a dose-dependent manner. At 4 mM t-BOOH, Na+/H+ exchange activity was virtually absent. This was accompanied by an increase in cytotoxicity (MTT assay). Glutathione repletion and intracellular Ca++ chelation partially restored the Na+/H+ exchange activity. Hydroperoxide seemed neither to alter the intracellular signal transduction pathways (cAMP and Ca++ oscillations) nor the membrane distribution of the exchanger (immunostaining). Decrease in Na+/H+ exchange activity in this model of oxidant stress may represent an early perturbation of membrane function, and the functional integrity of Na+/H+ exchange could therefore be dependent on the glutathione redox system.

Biliary epithelial cells are involved in water, electrolyte, sugar, bile and amino acid transport. They express several transporters, channels and regulatory receptors to modify the primary produced hepatocellular bile (1-3). Plasmalemmal Na+/H+ exchangers (NHE) are present in all mammalian cells, usually mediating H+ efflux and influx of Na+, and are expressed in several isoforms in epithelial tissues (4). In cholangiocytes four isoforms (NHE1-4) have been identified (2, 5, 6). The basolateral NHE1 is generally accepted as participating in intra- and pericellular pH and cell volume homeostasis. Besides its role in fluid and electrolyte transport i.e. secretin-induced ductular bile secretion (2, 7), it is also involved in cell–cell interaction and cell migration and cell development (8-10), thus forming a link between membrane transport processes, control of intra- and pericellular pH and tumor development. Indeed, NHE1 antisense gene transfection of human gastric carcinoma cells suppressed cell growth and partially reversed the malignant phenotype in a cell line (11). Cholangiocellular carcinoma (CCC) is the second most common primary liver cancer after hepatocellular carcinoma (HCC) in the western world with increasing incidence (12). Several risk factors for this tumor have been identified, such as congenital biliary malformations, primary sclerosing cholangitis (PSC), hepatolithiasis, parasitic infections, bile duct adenoma, biliary papillomatosis, drug exposure and genetic risks (13, 14). Chronic inflammation is thought to play a key role in carcinogenesis and dysregulation of inflammatory cytokines, growth factors and prostaglandins has been detected in several models of CCC. In addition, bile acids have been shown to activate inducible cyclooxygenase 2 and an antiapoptotic molecule in isolated cholangiocytes and in cancer cell lines (15, 16). Thus a chronic inflammatory environment and bile constituents act together to promote carcinogenesis in the biliary tract. That oxidative stress may play a role in this process has been suggested from observations that hydrophobic bile acids such as glycochenodeoxycholate increase reactive oxygen species (ROS) in isolated cholangiocytes and reduce intracellular glutathione levels. This is followed by marked changes in genes associated with carcinogenesis (17). Curative treatment of CCC is primarily based on radical surgery. Palliative approaches include photodynamic therapies (PDT) and combination chemotherapy (12, 14, 18). PDT is based on the light-activation of a photosensitizing compound, taken up by the tumor cells. After laser irradiation, ROS are produced, resulting in cell damage and cell death (19, 20).

Although oxidative stress is involved in different pathological and therapeutic conditions in the biliary tract, very little is known of its influence on sodium, proton exchange. The aim was therefore to analyze the influence of oxidative stress on NHE activity in biliary epithelial cells and on the pathways involved in its regulation. Additionally the toxicity of oxidative stress on the biliary epithelial cancer cell line (Mz-Cha-1 cells) was investigated.

Materials and Methods

Cell culture. The studies were performed using the human CCC line Mz-Cha-1 (21), which has previously been shown to express the biliary epithelial markers cytokeratin 19 and gamma-glutamyl transpeptidase and to possess phenotypic features of biliary origin, including Ca2+- and cAMP-dependent Cl−-conductance (22) and sodium proton exchange (23). The cells were kindly provided by A. Knuth (Zurich, Switzerland) and maintained in culture at 37°C in 5% CO2 in HCO3-containing DMEM (Gibco BRL, Grand Island, NY, USA) supplemented with 10% heat-inactivated fetal bovine serum, 1% l-glutamine, penicillin (100 IU/ml) and streptomycin (100 μg/ml).

Intracellular pH measurements. For the pH regulation studies, the medium was removed and the cells were washed with incubation buffer containing 135 mM NaCl, 5 mM KCl, 0.8 mM MgSO4, 1.2 mM CaCl2, 0.8 mM Na2HPO4, 10 mM N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic acid (HEPES, pH 7.4) and 5 mM glucose. The viability of the cells exceeded 75%.

The intracellular pH (pHi) was determined with the pH-sensitive fluorochrome 2’,7’-bis(carboxyethyl)-5(6)-carboxyfluorescein acetoxy-methyl ester (BCECF/AM) using a Perkin-Elmer luminescence spectrophotometer (LS 50) (Perkin-Elmer, Rodgau Jügesheim, Germany) at excitation and emission wavelengths of 480 and 530 nm, respectively. Excitation at 405 nm was employed to correct the readings at 480 nm for dye concentration, leakage and bleaching. For this purpose the Mz-Cha-1 cells were loaded with the fluorescent dye (2 μM) for 20 min in HEPES-buffered balanced salt solution containing 0.05% pluronic F 127 at room temperature. The cells were then washed twice with HEPES balanced salt solution and stored on ice. The experiments were carried out in a cuvette kept at 37°C under constant stirring.

To convert the fluorescence ratio 480:405 into pH units, the cells were suspended in nigericin/high potassium calibration solutions at pH 6.5-8. This technique utilizes the capability of nigericin (10 μM) to act as both a potassium and a proton ionophore. By raising the external potassium concentration to 140 mM the membrane potential is set at 0 mV and consequently pHi equalizes extracellular pH (pHo) (23).

Determination of Na+/H+ exchange activity. To assess the effect of oxidative stress on Na+/H+ exchange activity, recovery from an acid load was determined. In previous studies, we demonstrated that this recovery is solely mediated by the NHE1 isoform (25). The Mz-Cha-1 cells were acid preloaded by the ammonium chloride prepulse technique. The cells were loaded with BCECF/AM and subsequently incubated in a buffer where 30 mM NaCl had been substituted for 30 mM NH4Cl for 5 min. The cells were then resuspended in sodium-free HEPES-buffered balanced salt solution. NaCl was replaced by N-methyl-D-glucamine (NMDG)-Cl. Removing NH4Cl from the medium produced a rapid acidification of the cells. In the absence of bicarbonate and sodium, the recovery of pHi was negligable. On reintroduction of external sodium, the pHi increased rapidly. The rate of alkalinization, dpHi/dt, after adding external sodium was determined by linear regression analysis over the first 15 s following the supplementation of external sodium. The experiments were accomplished in the absence or presence of t-BOOH (tert-butyl-hydroperoxide) (Sigma-Aldrich, Munich, Germany) to induce oxidative stress. Na+/H+ exchange activity is regulated by different intracellular regulators. The effect of intracellular calcium was investigated by using the cell-permeable calcium chelator 2-bis(O-aminophenoxy)ethane-N,N,N’,N’-tetraacetic acid tetra(acetoxy-methyl) ester (BAPTA/AM) (Molecular probes, Leiden, the Netherlands). The proteinkinase A/cAMP system was investigated by the use of the cell permeable cAMP analogue N6,2’-O-dibutyryladenosine 3’,5’-cyclic monophosphate (dB-cAMP) (Sigma-Aldrich, Munich, Germany). The influence of protein kinase C was evaluated by use of the specific inhibitor genistein (Sigma-Aldrich). Poly(ADP-ribose)polymerase (PARS) activation by oxidative stress inhibits NHE in endothelial cells. This pathway was evaluated by using aminobenzamide (1 mM, 5 min incubation) (Sigma-Aldrich, Munich, Germany) as a specific inhibitor. To protect the biliary epithelial cancer cell line from the effects of t-BOOH exposure, cells were incubated for 24 h with 25 mM N-acetyl-L-cysteine (Sigma-Aldrich, Munich, Germany).

Determination of intracellular Ca2+ concentration by confocal laser scanning microscopy. Biliary epithelial cells express several membrane receptors coupled to calcium as a second messenger system (28). The effect of oxidative stress on biliary epithelial cell capability to generate intracellular Ca2+ signals was therefore investigated. Extracellular ATP is a strong agonist to induce intracellular Ca2+ signals via purinergic receptors. [Ca2+]i was measured using the Ca2+ sensitive fluorochrome, fluo-3-acetoxymethyl ester (Fluoro3/AM) (Molecular Probes) as previously described (24). Mz-Cha-1 cells were plated on cover slips 24 h prior to the studies. The cells were loaded with the membrane permeant dye by incubation for 30 to 40 min at 37°C with 5 μM Fluo3/AM in DMEM-medium containing supplements as described above and 0.05% pluronic F-127. The coverslips were placed on the stage of a laser scanning microscope (I×70) (Olympus, Hamburg, Germany) and continuously superfused with the extracellular buffer (described above). Cells were excited at 488 nm with an internal laser (argon/krypton laser Omnichome ©643R-OLYM-AO3, Melles Griot, Inc., Helium Neon Lasers, Carlsbad, CA, USA). Emission was recorded using a 525-565 nm band pass filter, and the data were transferred to a computer. Images were obtained every 5 s using the frame mode of the system. The data were analyzed using a self-generated computer-based algorithm to detect changes in intracellular fluorescence intensity.

Determination of cAMP. Since biliary epithelial cells are hormone sensitive and secretin activates cellular Cl−/HCO3− exchange via a c-AMP-mediated mechanism (27). The effect of t-BOOH on cellular cAMP formation was therefore investigated. Aliquots of 105 cells were transferred into wells and allowed to grow to 50-60% confluent monolayers (16-20 h). After washing, the cells were incubated for 5 min with the different agonists (1 ml) t-BOOH and/or forskolin (Sigma-Aldrich, Munich, Germany). Forskolin activates intracellular adenylyl cyclase and thereby cAMP formation. The reaction was stopped by addition of lysis buffer (0.1 M HCl, 10-20 min, 220/μl/well, 24-well plate). After centrifugation, the supernatant was used to determine cytosolic cAMP by the use of a commercial enzyme immunoassay (Sigma-Aldrich, St. Louis, MO, USA).

Cytotoxicity assay. For the assessment of t-BOOH cytotoxicity, the cells were incubated with different concentrations of t-BOOH (5 min) or with staurosporine (4 h) (Sigma-Aldrich, Munich, Germany). Staurosporine is a potent protein kinase inhibitor and induces cell death and apotosis in a variety of cells. Mz-Cha-1 cellular survival was assessed by means of reduction of MTT to the insoluble blue formazan catalyzed by mitochondrial and other cellular dehydrogenases (Roche Diagnostics, Mannheim, Germany). The cellular absorbance, indicative of remaining cellular activity, was read at 550 nm on a microplate photometer.

Expression of NHE1–cMyc fusion protein. A NHE1-expression construct was developed as follows. The total RNA was prepared from mouse brain using a High Pure RNA purification kit (Qiagen, Hilden, Germany). First strand cDNA was generated using a SuperScript II cDNA kit (Invitrogen, Darmstadt, Germany) with random hexamers (Invitrogen). The coding cDNA sequence (NM_016981) was amplified using standard techniques with the sense primer GAATTCATG ATGCTTCGGTGGTCCGGCGTCT and the antisense primer CTCGAGCTGTCCTTTGGGGATGAAAGGCTCTCCCT, which yielded a 2.47 kb fragment that was cloned with a TOPO TA Cloning kit into the pCR2.1-TOPO vector (Invitrogen). TOPO TA Cloning® provides a efficient cloning strategy for the direct insertion of Taq polymerase-amplified PCR products into a plasmid vector. For antibody recognition the Myc sequence was amplified using the pCS2+MT plasmid (XMMR) as a template with the sense primer GCCCTCGAGTTTAAAGCTATGGAGCAAAAGCTCA and the antisense primer GCCCTCGAGGCGGCCGCCTAGGTGAGGT CGCCCAAGCTCTCCATT.

This PCR fragment was cut with XhoI and ligated in frame into the C-terminal NHE1 cDNA of the pCR2.1-NHE1 plasmid via XhoI. The cDNA of NHE1 including the 5 C-terminal Myc tags was subsequently excised exploiting an EcoRI and a Not1 restriction site and cloned into the eucaryotic expression vector pCMV-Sport6. The plasmid was subsequently verified by sequencing.

Transfection. Mz-Cha-1 cells were grown on coverslips in 6-well plates and transfected with the NHE1-cMyc plasmid using N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methylsulfate (DOTAP) (Roche Diagnostics) with a DNA concentration of 2.5 μg per well and 3×105 cells per well. Cells were incubated for 5 hours with the DOTAP/DNA mixture in FCS containing DMEM. Before the experiments, the transfected cell were grown for 48 hours in HEPES (25 mmol/l) buffered DMEM in room air (37°C) containing 10% FCS. Before the experiments, the cells were washed three times with PBS.

Immunostaining. After the different experimental manipulations, the cells were washed in PBS and incubated sequentially for 15 min with 4% paraformaldeyde and 0.1% Triton ×100 for 10 min. Nonspecific binding was blocked by 10% FCS for 30 minutes. As primary antibody a commercial c-Myc rabbit polyclonal antibody (Santa Cruz Biotechnology, Heidelberg, Germany) was used at a dilution of 1:200. As a secondary antibody, a Cy2-coupled goat anti-rabbit IgG (Dianova, Hamburg, Germany) was used at a dilution of 1:100. After washing with PBS three times cells were mounted with movicol. Confocal images were generated using an inverted Leica confocal laser scanning microscope TCS SP5 (Leica, Wetzlar, Germany).

Figure 1.
Figure 1.

Effect of t-BOOH on Na+/H+ exchange activity in Mz-Cha-1 cells. Means±SD, n=10-15. *Significant difference from control (p<0.01).

Results

Effect of oxidative stress on Na+/H+ exchange activity. The recovery rate from acid load was diminished by t-BOOH exposure. This effect was dose dependent, implying a dose-dependent decrease in Na+/H+ exchange activity (Figure 1).

Influence of intracellular regulators on Na+/H+ exchange activity during oxidative stress inhibition. When the cells were pretreated with 20 μM BAPTA/AM to chelate intracellular Ca2+ the pHi recovery rate was 1.2±0.4 pH U/min compared to 0.4±0.3 pH U/min without BAPTA/AM after 1 mM t-BOOH exposure, indicating a role for Ca2+ in the regulation of Na+/H+ exchange activity.

Since Na+/H+ exchange is also regulated by cAMP the effect of the membrane permable analogue of dB-cAMP on Na+/H+ exchange inhibition by t-BOOH was investigated. One milimolar t-BOOH abolished Na+/H+ exchange activity. This effect was also obvious after preincuabtion with dB-cAMP, which excluded the involvement of the second messenger system protein kinase A/cAMP in this process.

After protein kinase C inhibition by genistein preincubation, the Na+/H+ exchange activity was 0.8±0.3 pH U/min after 1 mM t-BOOH treatment. Without genistein, no Na+/H+ exchange activity was detectable.

When cells were preincubated with 25 mM N-acetyl-L-cysteine for 24 h to restore glutathione levels the pHi recovery was 0.97±0.37 pH U/min, whereas without preincubation the pHi recovery was absent after 1 mM t-BOOH.

Figure 2.
Figure 2.

Intracellular cAMP levels in Mz-Cha-1 cells. Mean±SD, n=2-3 cell preparations. *Significant difference from basal stimulation (p<0.01).

Since oxidative stress induces poly(ADP-ribose)polymerase (PARS) activation and depletes cellular ATP levels, which inhibits Na+/H+ exchange in aortic endothelial cells (26), the Mz-Cha-1 cell line was incubated with the PARS-specific inhibitor 3-aminobenzamide prior to oxidative stress. This however did not revive the pHi recovery.

Effect of oxidative stress on intracellular cAMP formation. The results are shown in Figure 2. Incubating the cells with forskolin showed the capability of the biliary epithelial cell line to produce cAMP. Forskolin (1 μM) caused an increase of more the 150-fold in cellular cAMP levels. Oxidative stress mediated by the preincubation with t-BOOH also caused a slight increase in cellular cAMP levels and in addition, oxidative stress was unable to inhibit the forskolin induced increase in cellular cAMP. The data indicated that intracellular oxidative stress mediated by t-BOOH had no influence on adenylate cyclase and this second messenger system.

Effect of oxidative stress on intracellular Ca2+ signaling. The addition of 4 mM t-BOOH did not induce Ca2+ spikes or Ca2+ oscillations in the biliary epithelial cells. Furthermore, spontaneous Ca2+ oscillations, observed in several cells were not altered by t-BOOH. Treatment with ATP (100 μM) increased the oscillation frequency from 4×10−3 Hz to 27×10−3 Hz, or from 6×10−3 Hz to 26×10−3 Hz, while 4 mM t-BOOH had no influence on the oscillation frequency (Figure 3).

Cell toxicity. The cytotoxic effect of t-BOOH is shown in Figure 4. Up to a concentration of 4 mM, cellular survival (as assessed by the MTT assay) declined to about 60%. Staurosporine (0.5 and 1 μM) incubation of Mz-Cha1 cells for 4 h reduced viability to about 67% (Figure 4).

Effect of oxidative stress on NHE1–cMyc fusion protein. Under normal conditions in 75±4% of the cells the fusion protein was expressed in the area of the plasma membrane. Incubation with t-BOOH 1 mM showed no influence, indicating that Na+/H+ exchange activity was not regulated by retrieval of the exchange protein from the membrane (Figure 5).

Discussion

This study analyzed for the first time the effect of oxidative stress on Na+/H+ exchange activity in a well-defined model of biliary epithelial cells. t-BOOH diminished the NHE activity in a dose-dependent fashion, which was not mediated directly by intracellular messenger systems, but dependent on the presence of intracellular calcium. In addition, the ability of agents such as N-acetyl-L-cysteine to modify the effects of t-BOOH exposure was consistent with other observations that hydroperoxide exposure may lead to injury via oxidation of protein sulfhydryl groups (29, 30).

Figure 3.
Figure 3.

Intracellular Ca2+ in Mz-Cha-1 cells. Signals under basal conditions and during stimulation with extracellular ATP. Representative original recordings of 10 different cell preparations.

Figure 4.
Figure 4.

Mz-Cha-1 cell survival (MTT test). Mean±SD, n=3 different preparations. *Significant difference from control (p<0.01).

Inhibition of the NHE by oxidative stress has been reported previously in several cell types such as vascular endothelial cells (26, 31). The mechanisms however are not completely understood. Hu et al. demonstrated in aortic endothelial cells that H2O2 induced a rapid inhibition of Na+/H+ exchange by a process associated with poly(ADP-ribose) polymerase (PARS) activation and depletion of intracellular ATP (26). In the present study no influence of PARS activation was found since preincubation with 3-aminobenzamide, an inhibitor of PARS, had no effect on Na+/H+ exchange activity (data not shown). Thus it might be possible that oxidative stress fails to activate PARS in Mz-Cha-1 cells and therewith deplete cellular ATP levels, or this activation has no influence on Na+/H+ exchange activity in this cell line.

Figure 5.
Figure 5.

Confocal immunofluorescent staining of Mz-Cha-1 cells transfected with Na+/H+ exchanger type 1 (NHE1)–cMyc fusion protein showing plasma membrane staining under control conditions (a) and after t-BOOH (4 mM) exposure (b).

NHE activity can be modulated by a wide variety of stimuli including growth factors, tumor promoters and hormones including physical factors such as changes in cell volume or cell spreading (32). Activation of NHE is accompanied by extensive tyrosine phosphorylation. Genistein has been shown to impede not only tyrosine phosphorylation, but also NHE activation induced by hypertonic shock (33). In the present experimental setting, tyrosine phosphorylation had no effect on Na+/H+ exchange activity, thus excluding a pivotal role of phosphorylation of the membrane protein during oxidative stress.

NHE activity can be modified by the Ca2+/calmodulin system (34). In addition, intracellular Ca2+ plays a fundamental role in regulating numerous enzyme activities and mediating the effects of hormones and growth factors that control a wide variety of cellular processes, e.g. secretion (28). Furthermore, alteration in intracellular Ca2+ homeostasis is an early event in the development of irreversible cell injury (35). The chelation of intracellular Ca2+ reversed the oxidative stress induced inhibition of the exchanger in the present study. Thus it might be that intracellular Ca2+ is needed for the inhibition of NHE1 by oxidative stress and indeed, the calmodulin-binding domain of NHE1 has an autoinhibitory function since deletion leads to NHE1 activation (34). Thus, chelating Ca2+ by BAPTA could reduce the binding of calmodulin to its high affinity binding site and could therefore increase NHE1 activity. This regulation during oxidative stress is not receptor mediated since purinergic Ca2+ signals were not altered by t-BOOH. In contrast, pancreatic acinar cells showed an intracellular thapsigargin-insensitive, but ryanodine-sensitive liberation of intracellular Ca2+ upon exposure to oxidative stress and consequently showed time dependent cell damage (36). Sublytic concentrations of the hydroperoxide t-BOOH were found to produce an important disturbance in ion transport. A brief exposure to the hydroperoxide (30 min) produced a decrease in the magnitude of stimulated Ca2+ influx. If the exposure was prolonged (>2 h), the initial change was followed by a decrease in stimulated Ca2+ efflux leading to a persistent elevation of intracellular Ca2+ concentration (37, 38).

In the present setting, oxidative stress reduced cell viability to the same extent as staurosporine. However, only an approximately 40% cytotoxic effect could be achieved, which suggested that the CCC cells were not very susceptible to apoptotic stress factors.

Receptor-independent regulation of NHE includes the cytoskeleton (39). Previous studies have demonstrated that stimulation (40) and inhibition (25) of NHE1 involved different cytoskeleton elements. In the present study, direct visualization of NHE1 using an NHE1–cMyc fusion protein revealed staining of the plasma membrane during control and during oxidative stress conditions. This made retrieval of NHE1 from the plasma membrane as a regulatory mechanism during oxidative stress-induced inhibition, unlikely.

Exposure of cells to hydroperoxide is a well documented model of oxidant stress in different cell types (41, 42). t-BOOH is a membrane-permeable short-chain organic molecule that is metabolized by the glutathione peroxidase system after cellular uptake, leading to a depletion of intracellular glutathione (29). N-Acetyl-L-cysteine pretreatment of the cells to restore cellular glutathione levels showed an effect on the inhibition of NHE activity. Therefore, the disturbance of the NHE may represent an early perturbation of cell membrane function. The diminished activity could be related to alterations in the sensitivity of ion modifier sites that regulate the kinetic activity of the antiport.

In conclusion, t-BOOH dose-dependent inhibition of the NHE is dependent on the presence of intracellular calcium and intracellular glutathione levels. The inhibition of NHE by oxidative stress is cytotoxic and therefore a possible additional mechanism by which photodynamic therapy affects tumor cells. Pharmacological (43) or antisense gene therapy (11) to inhibit NHE could be possible treatment strategies for CCC.

  • Received August 3, 2010.
  • Revision received January 3, 2011.
  • Accepted January 5, 2011.

References

  1. ↵
    1. Elsing C,
    2. Kassner A,
    3. Hubner C,
    4. Buhli H,
    5. Stremmel W
    : Absorptive and secretory mechanisms in biliary epithelial cells. J Hepatol 24(Suppl 1): 121-127, 1996.
    OpenUrlPubMed
  2. ↵
    1. Hubner C,
    2. Stremmel W,
    3. Elsing C
    : Sodium, hydrogen exchange type 1 and bile ductular secretory activity in the guinea pig. Hepatology 31(3): 562-571, 2000.
    OpenUrlCrossRefPubMed
  3. ↵
    1. Esteller A
    : Physiology of bile secretion. World J Gastroenterol 14(37): 5641-5649, 2008.
    OpenUrlCrossRefPubMed
  4. ↵
    1. Kiela PR,
    2. Xu H,
    3. Ghishan FK
    : Apical Na+/H+ exchangers in the mammalian gastrointestinal tract. J Physiol Pharmacol 57(Suppl 7): 51-79, 2006.
    OpenUrl
  5. ↵
    1. Marti U,
    2. Elsing C,
    3. Renner E L,
    4. Liechti-Gallati S,
    5. Reichen J
    : Differential expression of Na(+),H(+)-antiporter mRNA in biliary epithelial cells and in hepatocytes. J Hepatol 24(4): 498-502, 1996.
    OpenUrlCrossRefPubMed
  6. ↵
    1. Mennone A,
    2. Biemesderfer D,
    3. Negoianu D,
    4. Yang CL,
    5. Abbiati T,
    6. Schultheis P J,
    7. Shull GE,
    8. Aronson PS,
    9. Boyer J L
    : Role of sodium/hydrogen exchanger isoform NHE3 in fluid secretion and absorption in mouse and rat cholangiocytes. Am J Physiol Gastrointest Liver Physiol 280(2): G247-254, 2001.
    OpenUrlPubMed
  7. ↵
    1. Hirata K,
    2. Nathanson MH
    : Bile duct epithelia regulate biliary bicarbonate excretion in normal rat liver. Gastroenterology 121(2): 396-406, 2001.
    OpenUrlCrossRefPubMed
  8. ↵
    1. Denker SP,
    2. Barber DL
    : Cell migration requires both ion translocation and cytoskeletal anchoring by the Na-H exchanger NHE1. J Cell Biol 159(6): 1087-1096, 2002.
    OpenUrlAbstract/FREE Full Text
    1. Lagana A,
    2. Vadnais J,
    3. Le PU,
    4. Nguyen TN,
    5. Laprade R,
    6. Nabi I R,
    7. Noel J
    : Regulation of the formation of tumor cell pseudopodia by the Na(+)/H(+) exchanger NHE1. J Cell Sci 113: 3649-3662, 2000.
    OpenUrlAbstract/FREE Full Text
  10. ↵
    1. Stuwe L,
    2. Muller M,
    3. Fabian A,
    4. Waning J,
    5. Mally S,
    6. Noel J,
    7. Schwab A,
    8. Stock C
    : pH dependence of melanoma cell migration: protons extruded by NHE1 dominate protons of the bulk solution. J Physiol 585: 351-360, 2007.
    OpenUrlCrossRefPubMed
  11. ↵
    1. Liu HF,
    2. Teng XC,
    3. Zheng JC,
    4. Chen G,
    5. Wang XW
    : Effect of NHE1 antisense gene transfection on the biological behavior of SGC-7901 human gastric carcinoma cells. World J Gastroenterol 14(14): 2162-2167, 2008.
    OpenUrlCrossRefPubMed
  12. ↵
    1. Ustundag Y,
    2. Bayraktar Y
    : Cholangiocarcinoma: a compact review of the literature. World J Gastroenterol 14(42): 6458-6466, 2008.
    OpenUrlCrossRefPubMed
  13. ↵
    1. Lazaridis KN,
    2. Gores GJ
    : Cholangiocarcinoma. Gastroenterology 128(6): 1655-1667, 2005.
    OpenUrlCrossRefPubMed
  14. ↵
    1. Malhi H,
    2. Gores GJ
    : Cholangiocarcinoma: modern advances in understanding a deadly old disease. J Hepatol 45(6): 856-867, 2006.
    OpenUrlCrossRefPubMed
  15. ↵
    1. Wu T,
    2. Leng J,
    3. Han C,
    4. Demetris AJ
    : The cyclooxygenase-2 inhibitor celecoxib blocks phosphorylation of Akt and induces apoptosis in human cholangiocarcinoma cells. Mol Cancer Ther 3(3): 299-307, 2004.
    OpenUrlAbstract/FREE Full Text
  16. ↵
    1. Han C,
    2. Leng J,
    3. Demetris A J,
    4. Wu T
    : Cyclooxygenase-2 promotes human cholangiocarcinoma growth: evidence for cyclooxygenase-2-independent mechanism in celecoxib-mediated induction of p21waf1/cip1 and p27kip1 and cell cycle arrest. Cancer Res 64(4): 1369-1376, 2004.
    OpenUrlAbstract/FREE Full Text
  17. ↵
    1. Komichi D,
    2. Tazuma S,
    3. Nishioka T,
    4. Hyogo H,
    5. Chayama K
    : Glycochenodeoxycholate plays a carcinogenic role in immortalized mouse cholangiocytes via oxidative DNA damage. Free Radic Biol Med 39(11): 1418-1427, 2005.
    OpenUrlCrossRefPubMed
  18. ↵
    1. Kiesslich T,
    2. Wolkersdorfer G,
    3. Neureiter D,
    4. Salmhofer H,
    5. Berr F
    : Photodynamic therapy for non-resectable perihilar cholangiocarcinoma. Photochem Photobiol Sci 8(1): 23-30, 2009.
    OpenUrlPubMed
  19. ↵
    1. Dolmans D E,
    2. Fukumura D,
    3. Jain RK
    : Photodynamic therapy for cancer. Nat Rev Cancer 3(5): 380-387, 2003.
    OpenUrlCrossRefPubMed
  20. ↵
    1. Plaetzer K,
    2. Kiesslich T,
    3. Oberdanner CB,
    4. Krammer B
    : Apoptosis following photodynamic tumor therapy: induction, mechanisms and detection. Curr Pharm 11(9): 1151-1165, 2005.
    OpenUrl
  21. ↵
    1. Knuth A,
    2. Gabbert H,
    3. Dippold W,
    4. Klein O,
    5. Sachsse W,
    6. Bitter-Suermann D,
    7. Prellwitz W,
    8. Meyer zum Buschenfelde KH
    : Biliary adenocarcinoma. Characterization of three new human tumor cell lines. J Hepatol 1(6): 579-596, 1985.
    OpenUrlCrossRefPubMed
  22. ↵
    1. Schlenker T,
    2. Fitz JG
    : Ca(2+)-activated C1-channels in a human biliary cell line: regulation by Ca2+/calmodulin-dependent protein kinase. Am J Physiol 271: G304-310, 1996.
    OpenUrlPubMed
  23. ↵
    1. Elsing C,
    2. Kassner A,
    3. Stremmel W
    : Sodium, hydrogen antiporter activation by extracellular adenosine triphosphate in biliary epithelial cells. Gastroenterology 111(5): 1321-1332, 1996.
    OpenUrlPubMed
  24. ↵
    1. Von Wegner F,
    2. Both M,
    3. Fink RH,
    4. Friedrich O
    : Fast XYT imaging of elementary calcium release events in muscle with multifocal multiphoton microscopy and wavelet denoising and detection. IEEE Trans Med Imaging 26(7): 925-934, 2007.
    OpenUrlCrossRefPubMed
  25. ↵
    1. Elsing C,
    2. Gosch I,
    3. Hennings JC,
    4. Hubner CA,
    5. Herrmann T
    . Mechanisms of hypotonic inhibition of the sodium, proton exchanger type 1 (NHE1) in a biliary epithelial cell line (Mz-Cha-1). Acta Physiol 190(3): 199-208, 2007.
    OpenUrl
  26. ↵
    1. Hu Q,
    2. Corda S,
    3. Zweier JL,
    4. Capogrossi MC,
    5. Ziegelstein RC
    : Hydrogen peroxide induces intracellular calcium oscillations in human aortic endothelial cells. Circulation 97(3): 268-275, 1998.
    OpenUrlAbstract/FREE Full Text
  27. ↵
    1. Kanno N,
    2. LeSage G,
    3. Glaser S,
    4. Alpini G
    : Regulation of cholangiocyte bicarbonate secretion. Am J Physiol Gastrointest Liver Physiol 281(3): G612-625, 2001.
    OpenUrlCrossRefPubMed
  28. ↵
    1. Minagawa N,
    2. Ehrlich BE,
    3. Nathanson MH
    : Calcium signaling in cholangiocytes World J Gastroenterol 12(22): 3466-3470, 2006.
    OpenUrl
  29. ↵
    1. Bellomo G,
    2. Jewell SA,
    3. Thor H,
    4. Orrenius S
    : Regulation of intracellular calcium compartmentation: studies with isolated hepatocytes and t-butyl hydroperoxide. Proc Natl Acad Sci 79(22): 6842-686, 1982.
    OpenUrlAbstract/FREE Full Text
  30. ↵
    1. Martensson J,
    2. Meister A
    : Mitochondrial damage in muscle occurs after marked depletion of glutathione and is prevented by giving glutathione monoester. Proc Natl Acad Sci 86(2): 471-475, 1989.
    OpenUrlAbstract/FREE Full Text
  31. ↵
    1. Shaw S,
    2. Naegeli P,
    3. Etter JD,
    4. Weidmann P
    : Inhibition of rat glomerular mesangial cell sodium/hydrogen exchange by hydrogen peroxide. Clin Exp Pharmacol Physiol 22(11): 817-823, 1995.
    OpenUrlCrossRefPubMed
  32. ↵
    1. Noel J,
    2. Pouyssegur J
    : Hormonal regulation, pharmacology, and membrane sorting of vertebrate Na+/H+ exchanger isoforms. Am J Physiol 268(2 Pt 1): C283-296, 1995.
    OpenUrlPubMed
  33. ↵
    1. Krump E,
    2. Nikitas K,
    3. Grinstein S
    : Induction of tyrosine phosphorylation and Na+/H+ exchanger activation during shrinkage of human neutrophils. J Biol Chem 272(28): 17303-17311, 1997.
    OpenUrlAbstract/FREE Full Text
  34. ↵
    1. Wakabayashi S,
    2. Bertrand B,
    3. Ikeda T,
    4. Pouyssegur J,
    5. Shigekawa M
    : Mutation of calmodulin-binding site renders the Na+/H+ exchanger (NHE1) highly H(+)-sensitive and Ca2+ regulation-defective. J Biol Chem 269(18): 13710-13715, 1994.
    OpenUrlAbstract/FREE Full Text
  35. ↵
    1. Alpini G,
    2. Kanno N,
    3. Phinizy JL,
    4. Glaser S,
    5. Francis H,
    6. Taffetani S,
    7. LeSage G
    : Tauroursodeoxycholate inhibits human cholangiocarcinoma growth via Ca2+-, PKC-, and MAPK-dependent pathways. Am J Physiol Gastrointest Liver Physiol 286(6): G973-982, 2004.
    OpenUrlCrossRefPubMed
  36. ↵
    1. Klonowski-Stumpe H,
    2. Schreiber R,
    3. Grolik M,
    4. Schulz HU,
    5. Haussinger D,
    6. Niederau C
    : Effect of oxidative stress on cellular functions and cytosolic free calcium of rat pancreatic acinar cells. Am J Physiol 272(6 Pt 1): G1489-1498, 1997.
    OpenUrlPubMed
  37. ↵
    1. Elliott SJ,
    2. Eskin SG,
    3. Schilling WP
    : Effect of t-butyl-hydroperoxide on bradykinin-stimulated changes in cytosolic calcium in vascular endothelial cells. J Biol Chem 264(7): 3806-3810, 1989.
    OpenUrlAbstract/FREE Full Text
  38. ↵
    1. Elliott SJ,
    2. Schilling WP
    : Oxidant stress alters Na+ pump and Na(+)-K(+)-Cl-cotransporter activities in vascular endothelial cells. Am J Physiol 263(1 Pt 2): H96-102, 1992.
    OpenUrlPubMed
  39. ↵
    1. Fliegel L
    : The Na+/H+ exchanger isoform 1. Int J Biochem Cell Biol 37(1): 33-37, 2005.
    OpenUrlCrossRefPubMed
  40. ↵
    1. Shrode LD,
    2. Klein JD,
    3. O'Neill WC,
    4. Putnam RW
    : Shrinkage-induced activation of Na+/H+ exchange in primary rat astrocytes: role of myosin light-chain kinase. Am J Physiol 269(1 Pt 1): C257-266, 1995.
    OpenUrlPubMed
  41. ↵
    1. Ahmed-Choudhury J,
    2. Orsler DJ,
    3. Coleman R
    : Hepatobiliary effects of tertiary-butylhydroperoxide (tBOOH) in isolated rat hepatocyte couplets. Toxicol Appl Pharmacol 152(1): 270-275, 1998.
    OpenUrlCrossRefPubMed
  42. ↵
    1. Cutaia M,
    2. Parks N
    : Oxidant stress decreases Na+/H+ antiport activity in bovine pulmonary artery endothelial cells. Am J Physiol 267(6 Pt 1): L649-659, 1994.
    OpenUrlPubMed
  43. ↵
    1. Di Sario A,
    2. Bendia E,
    3. Omenetti A,
    4. De Minicis S,
    5. Marzioni M,
    6. Kleemann HW,
    7. Candelaresi C,
    8. Saccomanno S,
    9. Alpini G,
    10. Benedetti A
    : Selective inhibition of ion transport mechanisms regulating intracellular pH reduces proliferation and induces apoptosis in cholangiocarcinoma cells. Dig Liver Dis 39(1): 60-69, 2007.
    OpenUrlPubMed
Back to top

In this issue

Print
Download PDF
Article Alerts
Email Article
Citation Tools
Reprints and Permissions
Oxidative Stress Reduces Na+/H+ Exchange (NHE) Activity in a Biliary Epithelial Cancer Cell Line (Mz-Cha-1)
CHRISTOPH ELSING, AGNIESZKA VOSS, THOMAS HERRMANN, IRIS KAISER, CHRISITAN A. HUEBNER, THORSTEN SCHLENKER
Anticancer Research Feb 2011, 31 (2) 459-465;
Twitter logo Facebook logo Mendeley logo

Jump to section