FEN1 is Overexpressed in Testis, Lung and Brain Tumors

Materials and Methods

Preparation of tumor tissue extracts. The collection of testicular and brain tumors was described elsewhere (22, 23). Specimens of surgically removed testicular tumors (n=25) and lung tumors (n=4) as well as the corresponding normal tissue from the same patient were stored in liquid nitrogen. The brain tumor samples [glioblastoma multiforme (n=13) and astrocytoma (n=7)] were compared with commercially available extracts from normal human cerebellum (BioChain, Hayward, CA, USA). For preparation of total tumor tissue extracts, the frozen tissue was crushed in a mortar and transferred to pre-chilled vials, sonicated in 180 μl buffer (20 mM Tris-HCl, pH 8.5; 1 mM EDTA, pH 8; 1 mM β-mercaptoethanol; 5% glycerin; protease-inhibitors: aprotinin 10 μg/ml; bestatin 10 μmol/l; leupeptin 10 μmol/l, pepstatinA 1 μmol/l, PMSF 0.1 mmol/l) and centrifuged at 14 000 rpm at 4°C for 10 min. The protein concentration was measured by Bradford with Roti-quant® (Roth, Karlsruhe, Germany) at a wavelength of 595 mm.

Western blot analysis. All loading samples were prepared by dilution with bi-distilled water and 4× load buffer (1:3, v/v) to a protein concentration of 1 μg/μl, boiled at 95°C for 5 min to denature the proteins, then briefly centrifuged and cooled on ice for 5 min. A volume of 30 μl per specimen was loaded onto 4% SDS stacking gel/10% separation gel and run at 40 mA. Thereafter, proteins were blotted onto a nitrocellulose transfer membrane (Protran; Schleicher&Schuell, Dassel, Germany) overnight at 100 mA. Membranes were blocked for 1 h at room temperature in 5% (w/v) fat-free milk powder in phosphate-buffered saline (PBS) containing 0.2% Tween, then incubated overnight at 4°C with primary mouse anti-FEN1 antibody (1:500; Transduction Laboratories, Lexington, KY, USA), washed 3 times (10 min each) diluted in blocking buffer. After 3 washes in PBS containing 0.2% Tween, the membranes were incubated for 1h with a horse radish peroxidise-coupled secondary antibody (1:3000; Amersham Biosciences AB, Uppsala, Sweden) and blots were developed by a chemiluminescence detection system. All blots were exposed to the same film for 5 min in order to facilitate the comparison between the samples, then stripped, blocked again and incubated with rabbit anti-extracellular signal-regulated kinase2 (ERK2; Santa Cruz Biotechnology, Santa Cruz, CA, USA) used as a loading control, followed by a secondary anti-rabbit antibody. The films were illuminated in an InGenius system and stored by SynGene Snap v.6.05.01 and analysed by the SynGene Tool software v.3.01. (Syngene, Cambridge, UK). The data were plotted as percentage changes in relation to the expression of ERK2. The highest protein level of ERK2 was used to normalize the amount of protein in all samples.

Cell culture of human glioblastoma cells and transient transfection with FEN1 siRNA. The 21mer single-stranded RNA oligonucleotide sequences used were GCAGCACAAUGAUGAGUGCAA (sense) and UUCGUCGUGUUACUACUCACG (antisense) according to (24). They were synthesized at 20 nmol scale by Ambion (Austin, TX, USA) and the RNA strands were resuspended in the supplied nuclease-free water to obtain a final concentration of 100 μM. Annealing of the complementary strands was performed by mixing equal amounts of RNA in the annealing buffer supplied by Ambion followed by heating of the mixture to 90°C for 1 min and incubation at 37°C for 1 h. In control experiments, ‘scrambled’ siRNA (AllStars Negative control siRNA; Qiagen, Hilden, Germany) was used. Glioblastoma cells LN308 were maintained in DMEM/High Glucose (PAA, Pasching, Austria) supplemented with 10% fetal bovine serum (FBS, Biowest, Nuaille, France). The cells were passaged at subconfluence 4 times and 5×10⁴ cells were plated 24 h before transfection in 2.5 ml medium in 6-well plates. Transfections were performed using 40 nM siRNA per well and 2.9 μl Lipofectamine RNAiMAX (Invitrogen, Karlsruhe, Germany) in a total volume of 200 μl, with a complexation time of 30 min. Thereafter, the complexes were diluted to 1 ml and added to cells; after 24 h the transfection mixture was replaced with medium.

Preparation of cell extracts from LN308 cells. Cells were collected by trypsin/EDTA treatment, washed in serum-containing DMEM medium, and once in PBS and the cell pellet was resuspended in a homogenization buffer supplied with COMPLETE Mini Protease inhibitor cocktail (Roche Diagnostics, Mannheim, Germany), used according to the manufacturer's protocol. The lysate was sonicated six times (40 cycles) on ice using a Branson B15 SONIFIER cell disruptor. The lysate was then spun for 10 min at 14,000×g and the supernatant transferred to a new microcentrifuge tube. Total protein content was determined using Nanodrop ND-1000 spectrophotometer with ND-1000 v.3.0. software (PEQLAB, Erlangen, Germany). Western blot quantification and data analysis was performed as described above.

Treatment with genotoxins. Cells were treated 48 h following siRNA transfection. A 100 mM MMS (Sigma, Munich, Germany) stock solution was prepared by diluting MMS with sterile H₂O. Cells were treated with 0.5 mM MMS for 1 h and the medium was changed. ACNU and cisplatin (both from Sigma) stocks were prepared by dissolving the drugs in sterile H₂O and filtering. The concentration of the ACNU stock solution was 10 mM and of the cisplatin stock solution 1 mg/ml. TMZ (Schering-Plough, Kenilworth, NJ, USA) was dissolved in dimethylsulfoxide (DMSO) and diluted 2-fold in distilled water (stock 35 mM). Stocks were stored at -80°C. Cells were treated with 50 μM ACNU, 0.2 mM TMZ or 9 μg/ml cisplatin for 6 h, washed once and fresh medium was added.

Determination of apoptosis by flow cytometry. Both adherent and detached cells were collected at certain time-points following treatment and centrifuged at 1,000 rpm for 5 min. Pelleted cells were washed in cold PBS, suspended in 100 μl cold PBS and 2 ml ice-cold 70% ethanol and stored at -20°C up to 3-4 days. Before analysis, cells were treated with RNase (0.03 mg/ml) and subsequently stained with propidium iodide (16.5 mg/ml) in PBS. Samples were transferred to FACS microtubes and propidium iodide fluorescence was measured by flow cytometry (FACScalibur, Becton Dickinson, Heidelberg, Germany). For each variant, 10,000 cells were counted and the results were expressed as percentage of sub-diploid cells using WinMDI v.2.8 (J. Trotter). All apoptosis experiments were repeated 3 times. Statistical significance was tested by Mann-Whitney non-parametric test in SPSS v.11.0 for Windows™ (LEAD Technologies, Charlotte, NC, USA).

• Download figure
• Open in new tab
• Download powerpoint

Figure 1.

Protein expression of FEN1 in testis and lung tumors. Specimens of surgically removed seminomas (A) and lung tumors (B) were compared for FEN1 expression to the corresponding normal tissue from the same patient. ERK2 was used as loading control. The upper panel shows a representative Western blot. The lower panel shows the quantification, whereby the highest expressing sample was set to 100%. The quantification was expressed in relation to the loading control (ERK2).