Abstract
Background/Aim: Cellular senescence is an important tumor-suppressive mechanism that arrests the cell cycle of damaged cells after diverse stresses. This study aimed to elucidate the role of mitochondrial glutamine (Gln) metabolism in senescence cell-fate decision after DNA damage. Materials and Methods: β-galactosidase staining was used to determine senescence induction. The mechanistic target of rapamycin (mTOR) activity and p21 expression were examined by western blot. Cell proliferation and clonogenic growth were evaluated. Results: Inhibition of mitochondrial Gln metabolism suppressed DNA damage-induced senescence, whereas increased Gln anaplerosis resulted in a profound induction of senescence. Mechanistically, Gln anaplerosis mediated senescence induction by activating mTOR signaling upon DNA damage. Importantly, enhancing Gln anaplerosis could reduce the emergence of proliferative subpopulations of cancer cells after exposure to non-lethal doses of chemotherapeutic agents. Conclusion: Mitochondrial Gln metabolism is an important regulator of DNA damage-induced senescence, which may be used for developing effective therapeutic approaches.
Upon DNA damage, cells activate a tightly coordinated DNA damage response (DDR) ranging from the activation of survival/repair pathways to the initiation of cell cycle arrest or cell death (1). Much progress has been made in understanding the molecular regulators or pathways in the DDR, and defects in this important cellular response cause many human pathologies (2, 3). Although there is growing evidence that cellular metabolism underlies many cell-fate decisions, it is not well determined how metabolic changes affect cellular response to DNA damage.
Glutamine (Gln), the primary carbon and nitrogen donor, plays an essential role in cell proliferation, and thus many cancer cells exhibit increased Gln metabolism (4). In mitochondria, Gln is catabolized to the tricarboxylic acid (TCA) cycle intermediate α-ketoglutarate (αKG). This metabolism of Gln is the important anaplerotic step for the provision of carbon to fuel the TCA cycle (5, 6). Because intermediates of the TCA cycle are used to produce building blocks including nucleotides, amino acids and lipids, Gln anaplerosis is critical for cell proliferation. Intriguingly, it has been shown that mitochondria Gln metabolism functions as a metabolic switch at the decision of cells to commit to proliferate or undergo growth arrest in response to DNA damage (7). Genotoxic stresses trigger a block in the entry of Gln into the TCA cycle, which is required for the proper DDR such as DNA repair and cell cycle arrest (7).
When cells are exposed to various stress stimuli, they withdraw from the cell cycle and enter a state of growth arrest, referred to as cellular senescence (8). Premature senescence can be induced by oncogene activation, indicating that senescence is an important endogenous barrier to tumor initiation (9). Clinically, cancer cells are induced to a senescent state after radiation or genotoxic chemotherapy and this therapy-inducing senescence (TIS) has be linked with improved clinical results (10). Thus, TIS has been explored as an effective mean to induce persistent growth inhibition of cancer cells with low cytotoxicity and to potentiate combinational drug treatments.
Due to the pivotal role of mitochondrial Gln metabolism as a determinant of cell fate decision, we sought to elucidate its role in cellular senescence upon DNA damage and explored strategies to increase senescence of cancer cells after chemotherapy.
Materials and Methods
Cell culture. A549, HeLa and 8988T cell lines used in this work have been described before (11, 12). A549 and Hela were cultured in Dulbecco’s modified Eagle’s medium (LM001-07, Welgene, Gyeongsan, Republic of Korea) supplemented with 10% fetal bovine serum (FBS, 16000-044, Gibco, NY, USA) and penicillin/streptomycin (L0022-100, Biowest, Nuaillé, France). All cell lines were tested routinely for mycoplasma contamination by using a commercially available kit (Takara Bio Inc, Shinga, Japan).
Constructs and reagents. The following antibodies were used: GLS1 (ab93434, Abcam, Cambridge, MA, USA), p21 (ab109199, Abcam), S6K (2708, Cell Signaling Technology, Danvers, MA, USA), p-S6K (9234, Cell Signaling Technology) and β-actin (ABT264, Sigma, St. Louis, MO, USA). Doxorubicin, cisplatin, camptothecin, etoposide and rapamycin were purchased from Sigma. CB-839 was obtained from Selleckchem (Houston, TX, USA). shRNAs were described previously (11).
β-galactosidase (β-gal) staining. β-gal staining was performed as previously described (11). Briefly, cells were washed two times with PBS and fixed with 4% paraformaldehyde for 5 min. Then, cells were incubated at 37°C with β-gal staining solution overnight. Stained cells were evaluated using an inverted phase contrast microscope (Olympus, Center Valley, PA, USA). Percentages of at least 300 stained cells were calculated.
Western blotting. Cells were lysed with EZ-RIPA lysis buffer (WSE-7420, ATTO, Tokyo, Japan) supplemented with a protease inhibitor (ATTO) and a phosphatase inhibitor (ATTO). Cell lysates were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). After SDS-PAGE, proteins were transferred to Nitrocellulose membrane. Membranes were blocked for 1h in Tris-buffered saline (TBS) containing 5% Bovine Serum Albumin (BSA) and 0.1% Tween 20 (TBS-T) and subsequently were incubated with the primary antibody overnight at 4°C. The membranes were washed with TBS-T and incubated with a horseradish peroxidase-conjugated secondary antibody for 1h. Blots were visualized by ECL (W1015, Promega, Madison, WI, USA) and Luminescent Image Analysis System.
Clonogenic assay. Cells were plated in 6-well plates at 4×103 cells per well in 2 ml of media and treated with drugs the day after seeding. The following day, the cells were replaced by growth media. After 14 days, colonies were fixed with 80% methanol and stained with 0.2% crystal violet.
Quantitative RT-PCR. Total RNA was prepared with RNAiso Plus (9109, Takara Bio Inc) according to the manufacturer’s instructions. Briefly, 0.5 μg of total RNA was reverse-transcribed using the iScript cDNA synthesis kit (RR036A, Takara Bio Inc). Diluted cDNAs were analyzed by real-time PCR using SYBR Green I Mastermix on a Lightcycler 480 (04887352001, Roche, South San Francisco, CA, USA). The level of gene expression was normalized to β-actin. The primer sequences were: GTGGACCTGGCTGAGGAG and CTTTCAATCGGGGATGTCTG for human p16; GGCAGACCAGCA TGACAGATTT and GGCGGATTAGGGCTTCCTCT for human p21; GCCCTCCCCAGTCTCTCTTA and TCAAAACTCCCAAGCACC TC for human p27; and CTACGTCGCCCTGGACTTCGAGC and GATGGAGCCGCCGATCCACACGG for human β-actin.
Statistical analysis. Statistical analysis was performed using GraphPad Prism software (GraphPad Software, Inc, San Diego, CA, USA). The graphs show the mean from three independent experiments unless otherwise specified (SD is standard deviation and SEM is standard error of the mean). Statistically significant differences were calculated using unpaired two-tailed Student’s t-test or two-way ANOVA. A p-value of <0.05 was considered statistically significant.
Results
Mitochondrial glutamine metabolism regulates DNA damage-induced senescence. Given the essential role of mitochondrial Gln metabolism in the proper cellular DDR (7), we hypothesized that mitochondrial Gln metabolism could serve as an important regulator of DNA damage-induced senescence. To induce cellular senescence, A549 non-small cell lung cancer cells were treated with doxorubicin (DOX), a topoisomerase 2 inhibitor, which induces cellular senescence across various cancer cells and has been one of the most commonly used chemotherapeutic drugs (13). We observed that DOX treatment caused a profound induction in A549 cells expressing senescence-associated β-galactosidase (SA-β-Gal) and these cells exhibited recognizable enlarged and flattened morphologic phenotypes (Figure 1A and B). Because glutaminase (GLS) is the first required enzyme for mitochondrial Gln catabolic pathway and the incorporation of Gln-derived αKG into the TCA cycle is the important anaplerotic function of Gln metabolism, we assessed the role of mitochondrial Gln metabolism in DNA damage-induced senescence by adding CB-839, an inhibitor of GLS. Interestingly, GLS inhibition markedly suppressed DOX-induced senescence in A549 cells (Figure 1A and B). Conversely, when we tested whether enhanced Gln anaplerosis could increase DOX-induced senescence by adding membrane permeable dimethyl-αKG (DMKG), we found that DMKG treatment significantly elicited senescence after DNA damage (Figure 1A and B). Next, to confirm the importance of Gln anaplerosis in DNA damage-induced senescence, we reduced GLS expression by using short hairpin RNAs (shRNAs). Although GLS knockdown alone slightly induced cellular senescence without causing DNA damage as previously reported (11), we found that DOX-induced senescence was impeded in GLS knockdown cells (Figure 1C).
Next, to explore the mechanism underlying senescence regulation by Gln anaplerosis, we first examined key molecular mediators of senescence induction. Previous work showed that the cyclin-dependent kinase inhibitor p21 (CDKN1A) is responsible for DOX-induced senescence (13). We also found that p21 mRNA and protein levels were robustly induced after DOX treatment (Figure 1D and E). Importantly, DOX-induced p21 expression was decreased by CB-839 treatment, which was rescued by DMKG treatment (Figure 1D), indicating that mitochondrial Gln metabolism regulates DOX-induced senescence by modulating p21 expression.
Together, these results demonstrated a functional role of mitochondrial Gln metabolism in the senescence cell-fate decision upon DNA damage: enhanced Gln anaplerosis after drug treatment led cells to senescence.
Mitochondrial Gln metabolism regulates DNA damage-induced senescence through mTOR. The mechanistic target of rapamycin (mTOR) pathway has a pivotal role in cell fate decision (14). Previous studies have reported that high mTOR activity makes cells predisposed to senescence upon DNA damage or high cell density, whereas inhibition of the mTOR pathway leads to senescence avoidance (15, 16). Because mitochondrial Gln metabolism is an important modulator of mTOR signaling (17), we investigated whether Gln anaplerosis regulates DNA damage-induced senescence through the mTOR pathway. Indeed, we observed that GLS inhibition markedly suppressed phosphorylation of the ribosomal protein S6 kinase (S6K), a marker of mTOR activity, upon DNA damage, which could be reversed by DMKG treatment (Figure 2A). As a further test of the involvement of mTOR signaling in DOX-induced senescence, we investigated whether suppressing mTOR activity could block the effects of Gln anaplerosis. First, we confirmed that rapamycin, an inhibitor of mTOR, suppressed p21 induction after DOX treatment (Figure 2B). Next, we demonstrated that mTOR inhibition resulted in a decreased the number of SA-β-Gal positive cells after DOX treatment and reversed the elevated senescence induction by DMKG treatment (Figure 2C). These results indicate that Gln anaplerosis regulates DNA damage-induced senescence in an mTOR-dependent manner.
Mitochondrial Gln metabolism regulates senescence induction after treatment with chemotherapeutic drugs. Our data indicate that mitochondrial Gln anaplerosis may determine senescence cell fate after DOX treatment. Next, the importance of this pathway in DNA damage-induced senescence was further tested using other chemotherapeutic agents and cell lines. A549 cells were treated with CB-839 or DMKG during the drug treatment and the number of senescent cells was assessed. Although each DNA damaging drug exhibited different degrees of senescence induction, the number of SA-β-Gal positive cells decreased after CB-839 treatment but increased after DMKG treatment (Figure 3A). In addition, we observed similar results with 8988T pancreatic ductal adenocarcinoma and HeLa cervical cancer cells (Figure 3B). These suggest that Gln anaplerosis-dependent senescence outcomes may be a general phenomenon.
Enhanced Gln anaplerosis synergizes with chemotherapy to reduce proliferation. Chemotherapy usually relies on cytotoxic cell death. However, administration of toxic drugs and/or high dosage for inducing cell death can cause severe side effects and circumscribe their use as viable therapeutic strategies. Recent research suggests that TIS, which permanently arrests proliferation of cancer cells, may increase cancer treatment options (10). Our observations suggest that elevation of Gln anaplerosis may have therapeutic implications by leading cancer cells to senescence after chemotherapy. Therefore, we tested whether mitochondrial Gln metabolism could influence proliferation of cancer cells treated with chemotherapy. In line with our previous results, treatment with the combination of DOX and CB-839 resulted in a significant impairment of growth compared with DOX treatment alone (Figure 4A). Importantly, enhancing Gln anaplerosis by adding DMKG was more effective at suppressing cell growth after DOX treatment (Figure 4A). In addition, when we assessed their clonogenic growth, we observed similar results (Figure 4B). Taken together, our results suggest that the treatment aimed at enhancing Gln anaplerosis may potentially synergize with chemotherapy to reduce cancer cell proliferation.
Discussion
Here, we define an important role of mitochondrial Gln metabolism on DNA damage-induced senescence. Our study shows that Gln anaplerosis contributes to senescence induction by supplying αKG into the TCA cycle upon DNA damage. We found that the regulation of mTOR activity by Gln anaplerosis determines senescence induction. Importantly, enhanced Gln anaplerosis could promote cancer cells toward senescence after chemotherapy, highlighting the potential importance of this pathway in future therapeutic implications.
Our studies shed light on potential therapeutic strategies for cancer treatment. Although chemotherapy is designed to induce complete cellular destruction of cancer cells by using toxic compounds or high dose irradiation, these approaches also cause severe damage in normal cells and patients. Because of limited ranges and unavoidable declines in drug concentration, cancer cells can be exposed to non-lethal doses of DNA damaging therapy. In these conditions, cancer cells often develop resistance to the treatments and/or gain propensity to rapidly metastasize, highlighting the need to develop alternative strategies, which permanently disable the proliferative capacity of cancer cells, with fewer and less severe side effects related to cytotoxicity. We found that elevating mitochondrial Gln metabolism can lead cancer cells to senescence even under non-lethal doses of DNA damaging agents. Thus, these findings may have implications for therapeutic approaches as activation of Gln anaplerosis in cancer cells can potentially synergize with therapies that induce DNA damage, such as chemotherapy or radiation therapy.
Our findings are consistent with previous work showing that repression of mitochondrial Gln metabolism functions as an important regulator of the DDR (7). Jeong et al. found that defects in this metabolic block result in delayed cell cycle arrest and impaired DNA repair. Under these conditions, cells tend to accumulate DNA damage, which may force cells to permanent cell cycle arrest. This idea is adequately validated by our findings that elevated Gln anaplerosis by DMKG treatment increases senescence induction after DNA damage. As high dosages of DNA damaging agents may induce cell death instead of senescence, future work is aimed at determining whether mitochondrial Gln metabolism is also involved in DNA damage-induced cell death and how Gln anaplerosis participates in the senescence-death fate decision.
Cancer cells have distinct metabolic dependencies in comparison with their normal counterparts. One of these dependencies of cancer cells is the increased use of Gln, and thus, many efforts have been made to target Gln metabolism. Because GLS is the first required enzyme for mitochondrial Gln anaplerosis, clinical grade GLS inhibitors are being developed (18). However, we found that inhibition of Gln anaplerosis upon DNA damage allows cells to avoid senescence, which increases the proliferation of cancer cells after drug treatment. Therefore, further studies are needed for delineating more precise roles of Gln anaplerosis after DNA damage.
In summary, our studies illustrate that mitochondrial Gln metabolism functions as a regulator of DNA damage-induced senescence, in part by modulating TCA cycle anaplerosis. These findings suggest that the regulation of Gln anaplerosis could provide an important area for therapeutic interventions for cancer.
Acknowledgements
This research was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (2018R1D1A1B07040961 and 2019R1A2C1089937).
Footnotes
↵* These Authors contributed equally to this work.
Authors’ Contributions
Byungjoo Kim and Jihye Gwak conducted the experiments and drafted the manuscript under the supervision of Seung Min Jeong. Seung Min Jeong conceived the idea for this study, wrote and edited the manuscript. Eun Kyung Lee provided conceptual advice. All Authors read and approved the final manuscript.
Conflicts of Interest
The Authors declare no conflicts of interest regarding this study.
- Received October 3, 2020.
- Revision received October 13, 2020.
- Accepted October 14, 2020.
- Copyright © 2020 International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.